UBE2C (NM_181801) Human Untagged Clone

SKU
SC320726
UBE2C (untagged)-Human ubiquitin-conjugating enzyme E2C (UBE2C), transcript variant 4
$150.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol UBE2C
Synonyms dJ447F3.2; UBCH10
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_181801.1 GTCGTGTTCTCCGAGTTCCTGTCTCTCTGCCAACGCCGCCCGGATGGCTTCCCAAAACCG
CGACCCAGCCGCCACTAGCGTCGCCGCCGCCCGTAAAGGAGCTGAGCCGAGCGGGGGCGC
CGCCCGGGGTCCGGTGGGCAAAAGGCTACAGCAGGAGCTGATGACCCTCATGATGTCTGG
CGATAAAGGGATTTCTGCCTTCCCTGAATCAGACAACCTTTTCAAATGGGTAGGGACCAT
CCATGGAGCAGCTGGAACAGTATATGAAGACCTGAGGTATAAGCTCTCGCTAGAGTTCCC
CAGTGGCTACCCTTACAATGCGCCCACAGTGAAGTTCCTCACGCCCTGCTATCACCCCAA
CGTGGACACCCAGGGTAACATATGCCTGGACATCCTGAAGGAAAAGTGGTCTGCCCTGTA
TGATGTCAGGACCATTCTGCTCTCCATCCAGAGCCTTCTAGGAGAACCCAACATTGATAG
TCCCTTGAACACACATGCTGCCGAGCTCTGGAAAAACCCCACAGCTTTTAAGAAGTACCT
GCAAGAAACCTACTCAAAGCAGGTCACCAGCCAGGAGCCCTGACCCAGGCTGCCCAGCCT
GTCCTTGTGTCGTCTTTTTAATTTTTCCTTAGATGGTCTGTCCTTTTTGTGATTTCTGTA
TAGGACTCTTTATCTTGAGCTGTGGTATTTTTGTTTTGTTTTTGTCTTTTAAATTAAGCC
TCGGTTGAGCCCTTGTATATTAAATAAATGCATTTTTGTCCTTTTTTAGACAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire
ACCN NM_181801
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_181801.1, NP_861517.1
RefSeq Size 936 bp
RefSeq ORF 423 bp
Locus ID 11065
UniProt ID O00762
Cytogenetics 20q13.12
Protein Families Druggable Genome
Protein Pathways Ubiquitin mediated proteolysis
Summary The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, ubiquitin-conjugating enzymes, and ubiquitin-protein ligases. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. The encoded protein is required for the destruction of mitotic cyclins and for cell cycle progression, and may be involved in cancer progression. Multiple transcript variants encoding different isoforms have been found for this gene. Pseudogenes of this gene have been defined on chromosomes 4, 14, 15, 18, and 19. [provided by RefSeq, Aug 2013]
Transcript Variant: This variant (4) has an alternate 5'-terminal exon and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (4) has a shorter N-terminus, compared to isoform 1.
Write Your Own Review
You're reviewing:UBE2C (NM_181801) Human Untagged Clone
Your Rating
SKU Description Size Price
RC200240 UBE2C (Myc-DDK-tagged)-Human ubiquitin-conjugating enzyme E2C (UBE2C), transcript variant 4 10 ug
$300.00
RC200240L3 Lenti ORF clone of Human ubiquitin-conjugating enzyme E2C (UBE2C), transcript variant 4, Myc-DDK-tagged 10 ug
$600.00
RC200240L4 Lenti ORF clone of Human ubiquitin-conjugating enzyme E2C (UBE2C), transcript variant 4, mGFP tagged 10 ug
$600.00
RG200240 UBE2C (tGFP-tagged) - Human ubiquitin-conjugating enzyme E2C (UBE2C), transcript variant 4 10 ug
$489.00 MSRP $500.00 MSRP $500.00
SC309619 UBE2C (untagged)-Human ubiquitin-conjugating enzyme E2C (UBE2C), transcript variant 4 10 ug
$165.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.