BAP1 (NM_004656) Human Untagged Clone

CAT#: SC320669

BAP1 (untagged)-Human BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase) (BAP1)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name BAP1 (NM_004656) Human Untagged Clone
Symbol BAP1
Synonyms HUCEP-13; hucep-6; UCHL2
Vector pCMV6-AC
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_004656.2 GCCCGTTGTCTGTGTGTGGGACTGAGGGGCCCCGGGGGCGGTGGGGGCTCCCGGTGGGGG
CAGCGGTGGGGAGGGAGGGCCTGGACATGGCGCTGAGGGGCCGCCCCGCGGGAAGATGAA
TAAGGGCTGGCTGGAGCTGGAGAGCGACCCAGGCCTCTTCACCCTGCTCGTGGAAGATTT
CGGTGTCAAGGGGGTGCAAGTGGAGGAGATCTACGACCTTCAGAGCAAATGTCAGGGCCC
TGTATATGGATTTATCTTCCTGTTCAAATGGATCGAAGAGCGCCGGTCCCGGCGAAAGGT
CTCTACCTTGGTGGATGATACGTCCGTGATTGATGATGATATTGTGAATAACATGTTCTT
TGCCCACCAGCTGATACCCAACTCTTGTGCAACTCATGCCTTGCTGAGCGTGCTCCTGAA
CTGCAGCAGCGTGGACCTGGGACCCACCCTGAGTCGCATGAAGGACTTCACCAAGGGTTT
TAGCCCTGAGAGCAAAGGATATGCGATTGGCAATGCCCCGGAGTTGGCCAAGGCCCATAA
TAGCCATGCCAGGCCCGAGCCACGCCACCTCCCTGAGAAGCAGAATGGCCTTAGTGCAGT
GCGGACCATGGAGGCGTTCCACTTTGTCAGCTATGTGCCTATCACAGGCCGGCTCTTTGA
GCTGGATGGGCTGAAGGTCTACCCCATTGACCATGGGCCCTGGGGGGAGGACGAGGAGTG
GACAGACAAGGCCCGGCGGGTCATCATGGAGCGTATCGGCCTCGCCACTGCAGGGGAGCC
CTACCACGACATCCGCTTCAACCTGATGGCAGTGGTGCCCGACCGCAGGATCAAGTATGA
GGCCAGGCTGCATGTGCTGAAGGTGAACCGTCAGACAGTACTAGAGGCTCTGCAGCAGCT
GATAAGAGTAACACAGCCAGAGCTGATTCAGACCCACAAGTCTCAAGAGTCACAGCTGCC
TGAGGAGTCCAAGTCAGCCAGCAACAAGTCCCCGCTGGTGCTGGAAGCAAACAGGGCCCC
TGCAGCCTCTGAGGGCAACCACACAGATGGTGCAGAGGAGGCGGCTGGTTCATGCGCACA
AGCCCCATCCCACAGCCCTCCCAACAAACCCAAGCTAGTGGTGAAGCCTCCAGGCAGCAG
CCTCAATGGGGTTCACCCCAACCCCACTCCCATTGTCCAGCGGCTGCCGGCCTTTCTAGA
CAATCACAATTATGCCAAGTCCCCCATGCAGGAGGAAGAAGACCTGGCGGCAGGTGTGGG
CCGCAGCCGAGTTCCAGTCCGCCCACCCCAGCAGTACTCAGATGATGAGGATGACTATGA
GGATGACGAGGAGGATGACGTGCAGAACACCAACTCTGCCCTTAGGTATAAGGGGAAGGG
AACAGGGAAGCCAGGGGCATTGAGCGGTTCTGCTGATGGGCAACTGTCAGTGCTGCAGCC
CAACACCATCAACGTCTTGGCTGAGAAGCTCAAAGAGTCCCAGAAGGACCTCTCAATTCC
TCTGTCCATCAAGACTAGCAGCGGGGCTGGGAGTCCGGCTGTGGCAGTGCCCACACACTC
GCAGCCCTCACCCACCCCCAGCAATGAGAGTACAGACACGGCCTCTGAGATCGGCAGTGC
TTTCAACTCGCCACTGCGCTCGCCTATCCGCTCAGCCAACCCGACGCGGCCCTCCAGCCC
TGTCACCTCCCACATCTCCAAGGTGCTTTTTGGAGAGGATGACAGCCTGCTGCGTGTTGA
CTGCATACGCTACAACCGTGCTGTCCGTGATCTGGGTCCTGTCATCAGCACAGGCCTGCT
GCACCTGGCTGAGGATGGGGTGCTGAGTCCCCTGGCGCTGACAGAGGGTGGGAAGGGTTC
CTCGCCCTCCATCAGACCAATCCAAGGCAGCCAGGGGTCCAGCAGCCCAGTGGAGAAGGA
GGTCGTGGAAGCCACGGACAGCAGAGAGAAGACGGGGATGGTGAGGCCTGGCGAGCCCTT
GAGTGGGGAGAAATACTCACCCAAGGAGCTGCTGGCACTGCTGAAGTGTGTGGAGGCTGA
GATTGCAAACTATGAGGCGTGCCTCAAGGAGGAGGTAGAGAAGAGGAAGAAGTTCAAGAT
TGATGACCAGAGAAGGACCCACAACTACGATGAGTTCATCTGCACCTTTATCTCCATGCT
GGCTCAGGAAGGCATGCTGGCCAACCTAGTGGAGCAGAACATCTCCGTGCGGCGGCGCCA
AGGGGTCAGCATCGGCCGGCTCCACAAGCAGCGGAAGCCTGACCGGCGGAAACGCTCTCG
CCCCTACAAGGCCAAGCGCCAGTGAGGACTGCTGGCCCTGACTCTGCAGCCCACTCTTGC
CGTGTGGCCCTCACCAGGGTCCTTCCCTGCCCCACTTCCCCTTTTCCCAGTATTACTGAA
TAGTCCCAGCTGGAGAGTCCAGGCCCTGGGAATGGGAGGAACCAGGCCACATTCCTTCCA
TCGTGCCCTGAGGCCTGACACGGCAGATCAGCCCCATAGTGCTCAGGAGGCAGCATCTGG
AGTTGGGGCACAGCGAGGTACTGCAGCTTCCTCCACAGCCGGCTGTGGAGCAGCAGGACC
TGGCCCTTCTGCCTGGGCAGCAGAATATATATTTTACCTATCAAAAAAAAAAAAAAAAAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_004656.2 unedited
GCGATTGTATACGACTCCTATAGGGCGGCAAGGCAATCGGCACGAGGGCCCGTTGTCTGT
GTGTGGGACTGAGGGGCCCCGGGGGCGGTGGGGGCTCCCGGTGGGGGCAGCGGTGGGGAG
GGAGGGCCTGGACATGGCGCTGAGGGGCCGCCCCGCGGGAAGATGAATAAGGGCTGGCTG
GAGCTGGAGAGCGACCCAGGCCTCTTCACCCTGCTCGTGGAAGATTTCGGTGTCAAGGGG
GTGCAAGTGGAGGAGATCTACGACCTTCAGAGCAAATGTCAGGGCCCTGTATATGGATTT
ATCTTCCTGTTCAAATGGATCGAAGAGCGCCGGTCCCGGCGAAAGGTCTCTACCTTGGTG
GATGATACGTCCGTGATTGATGATGATATTGTGAATAACATGTTCTTTGCCCACCAGCTG
ATACCCAACTCTTGTGCAACTCATGCCTTGCTGAGCGTGCTCCTGAACTGCAGCAGCGTG
GACCTGGGACCCACCCTGAGTCGCATGAAGGACTTCACCAAGGGTTTTAGCCCTGAGAGC
AAAGGATATGCGATTGGCAATGCCCCGGAGTTGGCCAAGGCCCATAATAGCCATGCCAGG
CCCGAGCCACGCCACCTCCCCTGAGAAGCAGAATGGCCTTAGTGCAGTGCGGACCATGGA
GGCGTTCCACTTTGTCAGCTATGTGCCTATCACAGGCCGGCTCTTTGAGCTGGATGGGCT
GAAGGTCTACCCCATTGACCCATGGGCCCTGGGGGGAGGACGAGGAGTGGACAGAACAAG
GCCCGCGGGTCATCATGGACCGTATCGGCCTCGCCACTGCAGGGGAGCCCTTACCACGAC
ATCCGCTTTCAAACCTGTATGCCATTGTGCCTGACCCGCGGATCAAGTATTGAAAGCCAG
GCTGCATTGGTGCTGAAGGTGTGACTCCGTTCGAGAGACGGTACTATAGAAG
Restriction Sites Please inquire     
Tag Tag Free
ACCN NM_004656
ORF Size 2190 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_004656.2, NP_004647
RefSeq Size 3599
Locus ID 8314
Cytogenetics 3p21.1
Domains Peptidase_C12
Protein Families Protease, Druggable Genome
Gene Summary This gene belongs to the ubiquitin C-terminal hydrolase subfamily of deubiquitinating enzymes that are involved in the removal of ubiquitin from proteins. The encoded enzyme binds to the breast cancer type 1 susceptibility protein (BRCA1) via the RING finger domain of the latter and acts as a tumor suppressor. In addition, the enzyme may be involved in regulation of transcription, regulation of cell cycle and growth, response to DNA damage and chromatin dynamics. Germline mutations in this gene may be associated with tumor predisposition syndrome (TPDS), which involves increased risk of cancers including malignant mesothelioma, uveal melanoma and cutaneous melanoma. [provided by RefSeq, May 2013].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.