Aldolase C (ALDOC) (NM_005165) Human Untagged Clone

SKU
SC320621
ALDOC (untagged)-Human aldolase C, fructose-bisphosphate (ALDOC)
$457.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Aldolase C
Synonyms ALDC
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_005165, the custom clone sequence may differ by one or more nucleotides


ATGCCTCACTCGTACCCAGCCCTTTCTGCTGAGCAGAAGAAGGAGTTGTCTGACATTGCCCTGCGGATTG
TAGCCCCGGGCAAAGGCATTCTGGCTGCGGATGAGTCTGTAGGCAGCATGGCCAAGCGGCTGAGCCAAAT
TGGGGTGGAAAACACAGAGGAGAACCGCCGGCTGTACCGCCAGGTCCTGTTCAGTGCTGATGACCGTGTG
AAAAAGTGCATTGGAGGCGTCATTTTCTTCCATGAGACCCTCTACCAGAAAGATGATAATGGTGTTCCCT
TCGTCCGAACCATCCAGGATAAGGGCATCGTCGTGGGCATCAAGGTTGACAAGGGTGTGGTGCCTCTAGC
TGGGACTGATGGAGAAACCACCACTCAAGGGCTGGATGGGCTCTCAGAACGCTGTGCCCAATACAAGAAG
GATGGTGCTGACTTTGCCAAGTGGCGCTGTGTGCTGAAAATCAGTGAGCGTACACCCTCTGCACTTGCCA
TTCTGGAGAACGCCAACGTGCTGGCCCGTTATGCCAGTATCTGCCAGCAGAATGGCATTGTGCCTATTGT
GGAACCTGAAATATTGCCTGATGGAGACCACGACCTCAAACGTTGTCAGTATGTTACAGAGAAGGTCTTG
GCTGCTGTGTACAAGGCCCTGAGTGACCATCATGTATACCTGGAGGGGACCCTGCTCAAGCCCAACATGG
TGACCCCGGGCCATGCCTGTCCCATCAAGTATACCCCAGAGGAGATTGCCATGGCAACTGTCACTGCCCT
GCGTCGCACTGTGCCCCCAGCTGTCCCAGGAGTGACCTTCCTGTCTGGGGGTCAGAGCGAAGAAGAGGCA
TCATTCAACCTCAATGCCATCAACCGCTGCCCCCTTCCCCGACCCTGGGCGCTTACCTTCTCCTATGGGC
GTGCCCTGCAAGCCTCTGCACTCAATGCCTGGCGAGGGCAACGGGACAATGCTGGGGCTGCCACTGAGGA
GTTCATCAAGCGGGCTGAGGTGAATGGGCTTGCAGCCCAGGGCAAGTATGAAGGCAGTGGAGAAGATGGT
GGAGCAGCAGCACAGTCACTCTACATTGCCAACCATGCCTACTGA


Restriction Sites Please inquire
ACCN NM_005165
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_005165.2, NP_005156.1
RefSeq Size 1665 bp
RefSeq ORF 1095 bp
Locus ID 230
UniProt ID P09972
Cytogenetics 17q11.2
Domains glycolytic_enzy
Protein Pathways Fructose and mannose metabolism, Glycolysis / Gluconeogenesis, Metabolic pathways, Pentose phosphate pathway
Summary This gene encodes a member of the class I fructose-biphosphate aldolase gene family. Expressed specifically in the hippocampus and Purkinje cells of the brain, the encoded protein is a glycolytic enzyme that catalyzes the reversible aldol cleavage of fructose-1,6-biphosphate and fructose 1-phosphate to dihydroxyacetone phosphate and either glyceraldehyde-3-phosphate or glyceraldehyde, respectively. [provided by RefSeq, Jul 2008]
Write Your Own Review
You're reviewing:Aldolase C (ALDOC) (NM_005165) Human Untagged Clone
Your Rating
SKU Description Size Price
RC200333 ALDOC (Myc-DDK-tagged)-Human aldolase C, fructose-bisphosphate (ALDOC) 10 ug
$457.00
RC200333L1 Lenti ORF clone of Human aldolase C, fructose-bisphosphate (ALDOC), Myc-DDK-tagged 10 ug
$757.00
RC200333L2 Lenti ORF clone of Human aldolase C, fructose-bisphosphate (ALDOC), mGFP tagged 10 ug
$757.00
RC200333L3 Lenti ORF clone of Human aldolase C, fructose-bisphosphate (ALDOC), Myc-DDK-tagged 10 ug
$757.00
RC200333L4 Lenti ORF clone of Human aldolase C, fructose-bisphosphate (ALDOC), mGFP tagged 10 ug
$757.00
RG200333 ALDOC (tGFP-tagged) - Human aldolase C, fructose-bisphosphate (ALDOC) 10 ug
$489.00 MSRP $657.00 MSRP $657.00
SC116885 ALDOC (untagged)-Human aldolase C, fructose-bisphosphate (ALDOC) 10 ug
$457.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.