14-3-3 epsilon (YWHAE) (NM_006761) Human Untagged Clone

CAT#: SC320619

Reviews ()
Write a review

YWHAE (untagged)-Human tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide (YWHAE), transcript variant 1


Product Datasheet for 'SC320619'


  "NM_006761" in other vectors (7)

Need a mutant or fragment? Switch to a different vector? Get a free quote.

USD 310.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name 14-3-3 epsilon (YWHAE) (NM_006761) Human Untagged Clone
Type Human Untagged Clone
Tag Tag Free
Symbol YWHAE
Synonyms 14-3-3E; HEL2; KCIP-1; MDCR; MDS
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_006761.3 CGGAGCGAGAGGCTGAGAGAGTCGGAGACACTATCCGCTTCCATCCGTCGCGCAGACCCT
GCCGGAGCCGCTGCCGCTATGGATGATCGAGAGGATCTGGTGTACCAGGCGAAGCTGGCC
GAGCAGGCTGAGCGATACGACGAAATGGTGGAGTCAATGAAGAAAGTAGCAGGGATGGAT
GTGGAGCTGACAGTTGAAGAAAGAAACCTCCTATCTGTTGCATATAAGAATGTGATTGGA
GCTAGAAGAGCCTCCTGGAGAATAATCAGCAGCATTGAACAGAAAGAAGAAAACAAGGGA
GGAGAAGACAAGCTAAAAATGATTCGGGAATATCGGCAAATGGTTGAGACTGAGCTAAAG
TTAATCTGTTGTGACATTCTGGATGTACTGGACAAACACCTCATTCCAGCAGCTAACACT
GGCGAGTCCAAGGTTTTCTATTATAAAATGAAAGGGGACTACCACAGGTATCTGGCAGAA
TTTGCCACAGGAAACGACAGGAAGGAGGCTGCGGAGAACAGCCTAGTGGCTTATAAAGCT
GCTAGTGATATTGCAATGACAGAACTTCCACCAACGCATCCTATTCGCTTAGGTCTTGCT
CTCAATTTTTCCGTATTCTACTACGAAATTCTTAATTCCCCTGACCGTGCCTGCAGGTTG
GCAAAAGCAGCTTTTGATGATGCAATTGCAGAACTGGATACGCTGAGTGAAGAAAGCTAT
AAGGACTCTACACTTATCATGCAGTTGTTACGTGATAATCTGACACTATGGACTTCAGAC
ATGCAGGGTGACGGTGAAGAGCAGAATAAAGAAGCGCTGCAGGACGTGGAAGACGAAAAT
CAGTGAGACATAAGCCAACAAGAGAAACCATCTCTGACCACCCCCTCCTCCCCATCCCAC
CCTTTGGAAACTCCCCATTGTCACTGAGAACCACCAAATCTGACTTTTACATTTGGTCTC
AGAATTTAGGTTCCTGCCCTGTTGGTTTTTTTTTTTTTTTTTTTAAACAGTTTTCAAAAG
TTCTTAAAGGCAAGAGTGAATTTCTGTGGATTTTACTGGTCCCAGCTTTTAGGTTCTTTA
AGACACTAACAGGACTACATAGAGGCTTTTTCAGCATTACTGTGTCGTCTCCGTGCCAGA
TGTGGCAAGATCACCATTAGCAAATGGAAATTACATTTGAAAGCCATTAGACTTACAGGT
GATGCAAGCATCTAAGAGAGAGGTTAATCACACTATAGAGGCATAAGTGGTATCAGTTTT
CATTTTTCTAATTGTTTAAACTGTGTTTTATACCAGTGTTTGCAAGTAATTGGGTGTTAG
CTTGAGATGGTTAAAGGTGGTTTGGGGAGGGACTTCGTTGTAATGGTTTTGCTGTAAAAA
ATGTTTCCAACTCCGCTGAAATGTTGCTGAAAAGCATGGTGCTGGTAACAGTTCAACAAT
CCGTGGCTGCTCATTCTTGCCTACTTTACTCTCCCACTGAAGCAGGTTAGCGTTGAAGGT
GGTATGGAAAAGCCTGCATGCCTGTTCAATTCTTTTGTTTCTTCTCCTTCCCCCTCCCCC
TACCTCCTTCCCCTCACTCCTCCCCTCCTTCGCTCGCTCAACCTCTTTTGTTCAGTATGT
GTAACTTGAAGCTAATTTGTACTACTGGATATCTGACTGGAGCCACAGATACAGAATCTG
TATTGTTCTTACTGAAACACAGCATGGAATTAACATTAAACTTAAATAAAACAAACCTAA
ATTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
>OriGene 5' read for NM_006761.3 unedited
CGTCCCATATGTATACGACCTCCTATAGGCGCGGCACAGGGAAACGGCACCGCCCCCGGA
GCGAGAGGCTGAGAGAGACGGAGACACTATCCGCTTCCATCCGTCGCGCAGACCCTGCCG
GAGCCGCTGCCGCTATGGATGATCGAGAGGATCTGGTGTACCAGGCGAAGCTGGCCGAGC
AGGCTGAGCGATACGACGAAATGGTGGAGTCAATGAAGAAAGTAGCAGGGATGGATGTGG
AGCTGACAGTTGAAGAAAGAAACCTCCTATCTGTTGCATATAAGAATGTGATTGGAGCTA
GAAGAGCCTCCTGGAGAATAATCAGCAGCATTGAACAGAAAGAAGAAAACAAGGGAGGAG
AAGACAAGCTAAAAATGATTCGGGAATATCGGCAAATGGTTGAGACTGAGCTAAAGTTAA
TCTGTTGTGACATTCTGGATGTACTGGACAAACACCTCATTCCAGCAGCTAACACTGGCG
AGTCCAAGGTTTTCTATTATAAAATGAAAGGGGACTACCACAGGTATCTGGCAGAATTTT
GCCACAGGAAACGACAGGAAAGAGGCTGCGGAGAACAGCCTAGTGGCTTATAAAGCTGCT
AGTGATATTGCATGACAGAACTTCCACCAACGCATCCTATTCGCTTAGTCTTGCTCTCAA
TTTTTCCGTATTCTACTACTAAAATTCCTAAATTCCCTGACCGTGCCTGCAGGTTTGGCA
AAGCAGCTTTTGGATGATGCATTTGCAGAACTGGATACGCTGAGTGAAGAAAGCTATAGG
ACTCTCCACTTATCATGGCCGTTGTTCGTGGATAATCTGACATCTAT
Restriction Sites Please inquire     
Tag Tag Free
ACCN NM_006761
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_006761.3, NP_006752.1
RefSeq Size 1810 bp
RefSeq ORF 768 bp
Locus ID 7531
Cytogenetics 17p13.3
Domains 14-3-3
Protein Families Druggable Genome
Protein Pathways Cell cycle, Neurotrophin signaling pathway, Oocyte meiosis
Gene Summary This gene product belongs to the 14-3-3 family of proteins which mediate signal transduction by binding to phosphoserine-containing proteins. This highly conserved protein family is found in both plants and mammals, and this protein is 100% identical to the mouse ortholog. It interacts with CDC25 phosphatases, RAF1 and IRS1 proteins, suggesting its role in diverse biochemical activities related to signal transduction, such as cell division and regulation of insulin sensitivity. It has also been implicated in the pathogenesis of small cell lung cancer. Two transcript variants, one protein-coding and the other non-protein-coding, have been found for this gene. [provided by RefSeq, Aug 2008]
Transcript Variant: This variant (1) represents the protein-coding transcript.

Other Versions

Other products for "YWHAE"
Frequently bought together (2)
Rabbit polyclonal anti-14-3-3 e antibody
    • 100 ul

USD 345.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones
Molbio tools