ILF2 (NM_004515) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | ILF2 |
Synonyms | NF45; PRO3063 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>OriGene sequence for NM_004515.2
GCGGCCTCCATTGTTCGTGTTTTAAGGCGCCATGAGGGGTGACAGAGGCCGTGGTCGTGG
TGGGCGCTTTGGTTCCAGAGGAGGCCCAGGAGGAGGGTTCAGGCCCTTTGTACCACATAT CCCATTTGACTTCTATTTGTGTGAAATGGCCTTTCCCCGGGTCAAGCCAGCACCTGATGA AACTTCCTTCAGTGAGGCCTTGCTGAAGAGGAATCAGGACCTGGCTCCCAATTCTGCTGA ACAGGCATCTATCCTTTCTCTGGTGACAAAAATAAACAATGTGATTGATAATCTGATTGT GGCTCCAGGGACATTTGAAGTGCAAATTGAAGAAGTTCGACAGGTGGGATCCTATAAAAA GGGGACAATGACTACAGGACACAATGTGGCTGACCTGGTGGTGATACTCAAGATTCTGCC AACGTTGGAAGCTGTTGCTGCCCTGGGGAACAAAGTCGTGGAAAGCCTAAGAGCACAGGA TCCTTCTGAAGTTTTAACCATGCTGACCAACGAAACTGGCTTTGAAATCAGTTCTTCTGA TGCTACAGTGAAGATTCTCATTACAACAGTGCCACCCAATCTTCGAAAACTGGATCCAGA ACTCCATTTGGATATCAAAGTATTGCAGAGTGCCTTAGCAGCCATCCGACATGCCCGCTG GTTCGAGGAAAATGCTTCTCAGTCCACAGTTAAAGTTCTCATCAGACTACTGAAGGACTT GAGGATTCGTTTTCCTGGCTTTGAGCCCCTCACACCCTGGATCCTTGACCTACTAGGCCA TTATGCTGTGATGAACAACCCCACCAGACAGCCTTTGGCCCTAAACGTTGCATACAGGCG CTGCTTGCAGATTCTGGCTGCAGGACTGTTCCTGCCAGGTTCAGTGGGTATCACTGACCC CTGTGAGAGTGGCAACTTTAGAGTACACACAGTCATGACCCTAGAACAGCAGGACATGGT CTGCTATACAGCTCAGACTCTCGTCCGAATCCTCTCACATGGTGGCTTTAGGAAGATCCT TGGCCAGGAGGGTGATGCCAGCTATCTTGCTTCTGAAATATCTACCTGGGATGGAGTGAT AGTAACACCTTCAGAAAAGGCTTATGAGAAGCCACCAGAGAAGAAGGAAGGAGAGGAAGA AGAGGAGAATACAGAAGAACCACCTCAAGGAGAGGAAGAAGAAAGCATGGAAACTCAGGA GTGACATTCCCTTCACTCCTTTTCCTACCCAAGGGGGAAGACTGGAGCCTAAGCTGCCTG CTACTGGGCTTTACATGGTGACAGACATTTCCGTGGGATAGGGAAGATAGCAGGAAGAAA AGTAAACTCCATAGAAGTGTCATTCCACTGGGTTTTGATATTGGCTTAGCTGCCAGTCTC CCATTTGTGACCTATGCCATCCATCTATAATGGAGGATACCAACATTTCTTCCTAATATT CTATAATCTCCAACTCCTGAAAACCCCTCTCTCAACTAATACTTTGCTGTTGAAATGTTG TGAAATGTTAAGTGTCTGGAAATTTTTTTTTCTAAGAAAAACTATTAAAGTACTTCCTAG TAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_004515 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_004515.2, NP_004506.2 |
RefSeq Size | 1637 bp |
RefSeq ORF | 1173 bp |
Locus ID | 3608 |
UniProt ID | Q12905 |
Cytogenetics | 1q21.3 |
Domains | DZF |
Protein Families | Druggable Genome, Transcription Factors |
Summary | The protein encoded by this gene is a transcription factor required for T-cell expression of the interleukin 2 gene. It also binds RNA and is an essential component for encapsidation and protein priming of hepatitis B viral polymerase. The encoded 45 kDa protein (NF45, ILF2) forms a complex with the 90 kDa interleukin enhancer-binding factor 3 (NF90, ILF3), and this complex has been shown to affect the redistribution of nuclear mRNA to the cytoplasm, to repair DNA breaks by nonhomologous end joining, and to negatively regulate the microRNA processing pathway. Knockdown of NF45 or NF90 protein retards cell growth, possibly by inhibition of mRNA stabilization. Alternative splicing results in multiple transcript variants. Related pseudogenes have been found on chromosomes 3 and 14. [provided by RefSeq, Dec 2014] Transcript Variant: This variant (1) encodes the longer isoform (1). |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC201751 | ILF2 (Myc-DDK-tagged)-Human interleukin enhancer binding factor 2, 45kDa (ILF2) | 10 ug |
$686.00
|
|
RC201751L1 | Lenti ORF clone of Human interleukin enhancer binding factor 2, 45kDa (ILF2), Myc-DDK-tagged | 10 ug |
$986.00
|
|
RC201751L2 | Lenti ORF clone of Human interleukin enhancer binding factor 2, 45kDa (ILF2), mGFP tagged | 10 ug |
$986.00
|
|
RC201751L3 | Lenti ORF clone of Human interleukin enhancer binding factor 2, 45kDa (ILF2), Myc-DDK-tagged | 10 ug |
$986.00
|
|
RC201751L4 | Lenti ORF clone of Human interleukin enhancer binding factor 2, 45kDa (ILF2), mGFP tagged | 10 ug |
$986.00
|
|
RG201751 | ILF2 (tGFP-tagged) - Human interleukin enhancer binding factor 2, 45kDa (ILF2) | 10 ug |
$886.00
|
|
SC126956 | ILF2 (untagged)-Human interleukin enhancer binding factor 2, 45kDa (ILF2) | 10 ug |
$457.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.