Triosephosphate isomerase (TPI1) (NM_000365) Human Untagged Clone

SKU
SC320334
TPI1 (untagged)-Human triosephosphate isomerase 1 (TPI1), transcript variant 1
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Triosephosphate isomerase
Synonyms HEL-S-49; TIM; TPI; TPID
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_000365.4 CTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTTCGTTGGGGGAAAC
TGGAAGATGAACGGGCGGAAGCAGAGTCTGGGGGAGCTCATCGGCACTCTGAACGCGGCC
AAGGTGCCGGCCGACACCGAGGTGGTTTGTGCTCCCCCTACTGCCTATATCGACTTCGCC
CGGCAGAAGCTAGATCCCAAGATTGCTGTGGCTGCGCAGAACTGCTACAAAGTGACTAAT
GGGGCTTTTACTGGGGAGATCAGCCCTGGCATGATCAAAGACTGCGGAGCCACGTGGGTG
GTCCTGGGGCACTCAGAGAGAAGGCATGTCTTTGGGGAGTCAGATGAGCTGATTGGGCAG
AAAGTGGCCCATGCTCTGGCAGAGGGACTCGGAGTAATCGCCTGCATTGGGGAGAAGCTA
GATGAAAGGGAAGCTGGCATCACTGAGAAGGTTGTTTTCGAGCAGACAAAGGTCATCGCA
GATAACGTGAAGGACTGGAGCAAGGTCGTCCTGGCCTATGAGCCTGTGTGGGCCATTGGT
ACTGGCAAGACTGCAACACCCCAACAGGCCCAGGAAGTACACGAGAAGCTCCGAGGATGG
CTGAAGTCCAACGTCTCTGATGCGGTGGCTCAGAGCACCCGTATCATTTATGGAGGCTCT
GTGACTGGGGCAACCTGCAAGGAGCTGGCCAGCCAGCCTGATGTGGATGGCTTCCTTGTG
GGTGGTGCTTCCCTCAAGCCCGAATTCGTGGACATCATCAATGCCAAACAATGAGCCCCA
TCCATCTTCCCTACCCTTCCTGCCAAGCCAGGGACTAAGCAGCCCAGAAGCCCAGTAACT
GCCCTTTCCCTGCATATGCTTCTGATGGTGTCATCTGCTCCTTCCTGTGGCCTCATCCAA
ACTGTATCTTCCTTTACTGTTTATATCTTCACCCTGTAATGGTTGGGACCAGGCCAATCC
CTTCTCCACTTACTATAATGGTTGGAACTAAACGTCACCAAGGTGGCTTCTCCTTGGCTG
AGAGATGGAAGGCGTGGTGGGATTTGCTCCTGGGTTCCCTAGGCCCTAGTGAGGGCAGAA
GAGAAACCATCCTCTCCCTTCTTACACCGTGAGGCCAAGATCCCCTCAGAAGGCAGGAGT
GCTGCCCTCTCCCATGGTGCCCGTGCCTCTGTGCTGTGTATGTGAACCACCCATGTGAGG
GAATAAACCTGGCACTAGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAA
Restriction Sites Please inquire
ACCN NM_000365
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_000365.4, NP_000356.1
RefSeq Size 1254 bp
RefSeq ORF 750 bp
Locus ID 7167
UniProt ID P60174
Cytogenetics 12p13.31
Domains TIM
Protein Pathways Fructose and mannose metabolism, Glycolysis / Gluconeogenesis, Inositol phosphate metabolism, Metabolic pathways
Summary This gene encodes an enzyme, consisting of two identical proteins, which catalyzes the isomerization of glyceraldehydes 3-phosphate (G3P) and dihydroxy-acetone phosphate (DHAP) in glycolysis and gluconeogenesis. Mutations in this gene are associated with triosephosphate isomerase deficiency. Pseudogenes have been identified on chromosomes 1, 4, 6 and 7. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009]
Transcript Variant: This variant (1) encodes the predominant isoform (1). CCDS Note: This CCDS represents a TPI variant that uses an internal promoter compared to the CCDS53740.1 representation. Data in PMIDs 4022011, 2925688, 2243103 and 10575546 support the presence of the internal promoter used by this variant. The resulting isoform is 37 aa shorter at the N-terminus compared to the CCDS53740.1 isoform. N-terminal sequencing in PMIDs 9150946 and 9150948 supports the existence of the shorter isoform in vivo.
Write Your Own Review
You're reviewing:Triosephosphate isomerase (TPI1) (NM_000365) Human Untagged Clone
Your Rating
SKU Description Size Price
RC202652 TPI1 (Myc-DDK-tagged)-Human triosephosphate isomerase 1 (TPI1), transcript variant 1 10 ug
$300.00
RC202652L1 Lenti ORF clone of Human triosephosphate isomerase 1 (TPI1), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC202652L2 Lenti ORF clone of Human triosephosphate isomerase 1 (TPI1), transcript variant 1, mGFP tagged 10 ug
$600.00
RC202652L3 Lenti ORF clone of Human triosephosphate isomerase 1 (TPI1), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC202652L4 Lenti ORF clone of Human triosephosphate isomerase 1 (TPI1), transcript variant 1, mGFP tagged 10 ug
$600.00
RG202652 TPI1 (tGFP-tagged) - Human triosephosphate isomerase 1 (TPI1), transcript variant 1 10 ug
$489.00 MSRP $500.00 MSRP $500.00
SC111041 TPI1 (untagged)-Human triosephosphate isomerase 1 (TPI1), transcript variant 1 10 ug
$300.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.