Heme Oxygenase 1(HMOX1) (NM_002133) Human Untagged Clone

CAT#: SC320297

HMOX1 (untagged)-Human heme oxygenase (decycling) 1 (HMOX1)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Heme Oxygenase 1(HMOX1) (NM_002133) Human Untagged Clone
Symbol HMOX1
Synonyms bK286B10; HMOX1D; HO-1; HSP32
Vector pCMV6-AC
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_002133 edited
CTCTCGAGCGTCCTCAGCGCAGCCGCCGCCCGCGGAGCCAGCACGAACGAGCCCAGCACC
GGCCGGATGGAGCGTCCGCAACCCGACAGCATGCCCCAGGATTTGTCAGAGGCCCTGAAG
GAGGCCACCAAGGAGGTGCACACCCAGGCAGAGAATGCTGAGTTCATGAGGAACTTTCAG
AAGGGCCAGGTGACCCGAGACGGCTTCAAGCTGGTGATGGCCTCCCTGTACCACATCTAT
GTGGCCCTGGAGGAGGAGATTGAGCGCAACAAGGAGAGCCCAGTCTTCGCCCCTGTCTAC
TTCCCAGAAGAGCTGCACCGCAAGGCTGCCCTGGAGCAGGACCTGGCCTTCTGGTACGGG
CCCCGCTGGCAGGAGGTCATCCCCTACACACCAGCCATGCAGCACTATGTGAAGCGGCTC
CACGAGGTGGGGCGCACAGAGCCCGAGCTGCTGGTGGCCCACGCCTACACCCGCTACCTG
GGTGACCTGTCTGGGGGCCAGGTGCTCAAAAAGATTGCCCAGAAAGCCCTGGACCTGCCC
AGCTCTGGCGAGGGCCTGGCCTTCTTCACCTTCCCCAACATTGCCAGTGCCACCAAGTTC
AAGCAGCTCTACCGCTCCCGCATGAACTCCCTGGAGATGACTCCCGCAGTCAGGCAGAGG
GTGATAGAAGAGGCCAAGACTGCGTTCCTGCTCAACATCCAGCTCTTTGAGGAGTTGCAG
GAGCTGCTGACCCATGACACCAAGGACCAGAGCCCCTCACGGGCACCAGGGCTTCGCCAG
CGGGCCAGCAACAAAGTGCAAGATTCTGCCCCCGTGGAGACTCCCAGAGGGAAGCCCCCA
CTCAACACCCGCTCCCAGGCTCCGCTTCTCCGATGGGTCCTTACACTCAGCTTTCTGGTG
GCGACAGTTGCTGTAGGGCTTTATGCCATGTGAATGCAGGCATGCTGGCTCCCAGGGCCA
TGAACTTTGTCCGGTGGAAGGCCTTCTTTCTAGAGAGGGAATTCTCTTGGCTGGCTTCCT
TACCGTGGGCACTGAAGGCTTTCAGGGCCTCCAGCCCTCTCACTGTGTCCCTCTCTCTGG
AAAGGAGGAAGGAGCCTATGGCATCTTCCCCAACGAAAAGCACATCCAGGCAATGGCCTA
AACTTCAGAGGGGGCGAAGGGATCAGCCCTGCCCTTCAGCATCCTCAGTTCCTGCAGCAG
AGCCTGGAAGACACCCTAATGTGGCAGCTGTCTCAAACCTCCAAAAGCCCTGAGTTTCAA
GTATCCTTGTTGACACGGCCATGACCACTTTCCCCGTGGGCCATGGCAATTTTTACACAA
ACCTGAAAAGATGTTGTGTCTTGTGTTTTTGTCTTATTTTTGTTGGAGCCACTCTGTTCC
TGGCTCAGCCTCAAATGCAGTATTTTTGTTGTGTTCTGTTGTTTTTATAGCAGGGTTGGG
GTGGTTTTTTGAGCCATGCGTGGGTGGGGAGGGAGGTGTTTAACGGCACTGTGGCCTTGG
TCTAACTTTTGTGTGAAATAATAAACAACATTGTCTGATAGTAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_002133.1 unedited
GTAGCATTGTATACGACTCCTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCG
AGGAGATCTGCCGCCGCGATCGCGGCGCGCCAGATCTCAAGCTTAACTAGTTAGCGGACC
GACGCGTTAAGCGGCCGCGAATTCAGATCCACAAGTTTGTACAAAAAAGCAGGCTTGTAA
AACGACGGCCAGTAACTATAACGGTCCTAAGGTAGCGAGGCCTGGGTGGCGAATTCGGCA
CGAGGCTCTCGAGCGTCCTCAGCGCAGCCGCCGCCCGCGGAGCCAGCACGAACGAGCCCA
GCACCGGCCGGATGGAGCGTCCGCAACCCGACAGCATGCCCCAGGATTTGTCAGAGGCCC
TGAAGGAGGCCACCAAGGAGGTGCACACCCAGGCAGAGAATGCTGAGTTCATGAGGAACT
TTCAGAAGGGCCAGGTGACCCGAGACGGCTTCAAGCTGGTGATGGCCTCCCTGTACCACA
TCTATGTGGCCCTGGAGGAGGAGATTGAGCGCAACAAGGAGAGCCCAGTCTTCGCCCCTG
TCTACTTCCCAGAAGAGCTGCACCGCAAGGCTGCCCTGGAGCAGGACCTGGCCTTCTGGT
ACGGGCCCCGCTGGCAGGAGGTCATCCCCTACACACCAGCCATGCAGCACTATGTGAAGC
GGCTCCACGAGGTGGGGCGCACAGAGCCCGAGCTGCTGGTGGCCCACGCCTACACCCGCT
ACCTGGGTGACCTGTCTGGGGGCCAGGTGCTCAAAAAGATTGCCCAGAAAGCCCTGGACC
TGCCCAGCTCTGGCGAGGGCCTGGCCCTTCTTCACCTTCCCCAACATTGCCAGTGCCACC
AAGTTCAAGCAGCTCTACCGCTCCCGCATGAACTCCCTGAGATGACTCCCGCAGTCAGCA
GAGGGTGGAAAGAAGAAGCCAAGACTGGCGTCCTGCTCAACATCAGCCTCTTTGGAGGAG
TGCAGGACTGCTGAACCCATGGACCCAAGAACAAAGAGCCCTCACGGCACCACAGGCC
Restriction Sites Please inquire     
Tag Tag Free
ACCN NM_002133
ORF Size 867 bp
Insert Size 1600
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_002133.1, NP_002124
RefSeq Size 1550
Locus ID 3162
Cytogenetics 22q12.3
Domains Heme_oxygenase
Protein Families Transmembrane, Druggable Genome
Protein Pathways Porphyrin and chlorophyll metabolism
Gene Summary Heme oxygenase, an essential enzyme in heme catabolism, cleaves heme to form biliverdin, which is subsequently converted to bilirubin by biliverdin reductase, and carbon monoxide, a putative neurotransmitter. Heme oxygenase activity is induced by its substrate heme and by various nonheme substances. Heme oxygenase occurs as 2 isozymes, an inducible heme oxygenase-1 and a constitutive heme oxygenase-2. HMOX1 and HMOX2 belong to the heme oxygenase family. [provided by RefSeq, Jul 2008].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations