AKT1 (NM_001014431) Human Untagged Clone

CAT#: SC320238

AKT1 (untagged)-Human v-akt murine thymoma viral oncogene homolog 1 (AKT1), transcript variant 3

USD 721


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name AKT1 (NM_001014431) Human Untagged Clone
Symbol AKT1
Synonyms AKT; CWS6; PKB; PKB-ALPHA; PRKBA; RAC; RAC-ALPHA
Vector pCMV6-AC
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_001014431.1 GGCGGCCGAGCACCGAGCGCTGGGCACCGGGCACCGAGCGGCGGCGGCACGCGAGGCCCG
GCCCCGAGCAGCGCCCCCGCCCGCCGCGGCCTCCAGCCCGGCCCCGCCCAGCGCCGGCCC
GCGGGGATGCGGAGCGGCGGGCGCCGGAGGCCGCGGCCCGGCTAGGCCCGCGCTCGCGCC
CGGACGCGGCGGCCCGAGGCTGTGGCCAGGCCAGCTGGGCTCGGGGAGCGCCAGCCTGAG
AGGAGCGCGTGAGCGTCGCGGGAGCCTCGGGCACCATGAGCGACGTGGCTATTGTGAAGG
AGGGTTGGCTGCACAAACGAGGGGAGTACATCAAGACCTGGCGGCCACGCTACTTCCTCC
TCAAGAATGATGGCACCTTCATTGGCTACAAGGAGCGGCCGCAGGATGTGGACCAACGTG
AGGCTCCCCTCAACAACTTCTCTGTGGCGCAGTGCCAGCTGATGAAGACGGAGCGGCCCC
GGCCCAACACCTTCATCATCCGCTGCCTGCAGTGGACCACTGTCATCGAACGCACCTTCC
ATGTGGAGACTCCTGAGGAGCGGGAGGAGTGGACAACCGCCATCCAGACTGTGGCTGACG
GCCTCAAGAAGCAGGAGGAGGAGGAGATGGACTTCCGGTCGGGCTCACCCAGTGACAACT
CAGGGGCTGAAGAGATGGAGGTGTCCCTGGCCAAGCCCAAGCACCGCGTGACCATGAACG
AGTTTGAGTACCTGAAGCTGCTGGGCAAGGGCACTTTCGGCAAGGTGATCCTGGTGAAGG
AGAAGGCCACAGGCCGCTACTACGCCATGAAGATCCTCAAGAAGGAAGTCATCGTGGCCA
AGGACGAGGTGGCCCACACACTCACCGAGAACCGCGTCCTGCAGAACTCCAGGCACCCCT
TCCTCACAGCCCTGAAGTACTCTTTCCAGACCCACGACCGCCTCTGCTTTGTCATGGAGT
ACGCCAACGGGGGCGAGCTGTTCTTCCACCTGTCCCGGGAGCGTGTGTTCTCCGAGGACC
GGGCCCGCTTCTATGGCGCTGAGATTGTGTCAGCCCTGGACTACCTGCACTCGGAGAAGA
ACGTGGTGTACCGGGACCTCAAGCTGGAGAACCTCATGCTGGACAAGGACGGGCACATTA
AGATCACAGACTTCGGGCTGTGCAAGGAGGGGATCAAGGACGGTGCCACCATGAAGACCT
TTTGCGGCACACCTGAGTACCTGGCCCCCGAGGTGCTGGAGGACAATGACTACGGCCGTG
CAGTGGACTGGTGGGGGCTGGGCGTGGTCATGTACGAGATGATGTGCGGTCGCCTGCCCT
TCTACAACCAGGACCATGAGAAGCTTTTTGAGCTCATCCTCATGGAGGAGATCCGCTTCC
CGCGCACGCTTGGTCCCGAGGCCAAGTCCTTGCTTTCAGGGCTGCTCAAGAAGGACCCCA
AGCAGAGGCTTGGCGGGGGCTCCGAGGACGCCAAGGAGATCATGCAGCATCGCTTCTTTG
CCGGTATCGTGTGGCAGCACGTGTACGAGAAGAAGCTCAGCCCACCCTTCAAGCCCCAGG
TCACGTCGGAGACTGACACCAGGTATTTTGATGAGGAGTTCACGGCCCAGATGATCACCA
TCACACCACCTGACCAAGATGACAGCATGGAGTGTGTGGACAGCGAGCGCAGGCCCCACT
TCCCCCAGTTCTCCTACTCGGCCAGCGGCACGGCCTGAGGCGGCGGTGGACTGCGCTGGA
CGATAGCTTGGAGGGATGGAGAGGCGGCCTCGTGCCATGATCTGTATTTAATGGTTTTTA
TTTCTCGGGTGCATTTGAGAGAAGCCACGCTGTCCTCTCGAGCCCAGATGGAAAGACGTT
TTTGTGCTGTGGGCAGCACCCTCCCCCGCAGCGGGGTAGGGAAGAAAACTATCCTGCGGG
TTTTAATTTATTTCATCCAGTTTGTTCTCCGGGTGTGGCCTCAGCCCTCAGAACAATCCG
ATTCACGTAGGGAAATGTTAAGGACTTCTGCAGCTATGCGCAATGTGGCATTGGGGGGCC
GGGCAGGTCCTGCCCATGTGTCCCCTCACTCTGTCAGCCAGCCGCCCTGGGCTGTCTGTC
ACCAGCTATCTGTCATCTCTCTGGGGCCCTGGGCCTCAGTTCAACCTGGTGGCACCAGAT
GCAACCTCACTATGGTATGCTGGCCAGCACCCTCTCCTGGGGGTGGCAGGCACACAGCAG
CCCCCCAGCACTAAGGCCGTGTCTCTGAGGACGTCATCGGAGGCTGGGCCCCTGGGATGG
GACCAGGGATGGGGGATGGGCCAGGGTTTACCCAGTGGGACAGAGGAGCAAGGTTTAAAT
TTGTTATTGTGTATTATGTTGTTCAAATGCATTTTGGGGGTTTTTAATCTTTGTGACAGG
AAAGCCCTCCCCCTTCCCCTTCTGTGTCACAGTTCTTGGTGACTGTCCCACCGGGAGCCT
CCCCCTCAGATGATCTCTCCACGGTAGCACTTGACCTTTTCGACGCTTAACCTTTCCGCT
GTCGCCCCAGGCCCTCCCTGACTCCCTGTGGGGGTGGCCATCCCTGGGCCCCTCCACGCC
TCCTGGCCAGACGCTGCCGCTGCCGCTGCACCACGGCGTTTTTTTACAACATTCAACTTT
AGTATTTTTACTATTATAATATAATATGGAACCTTCCCTCCAAATTCTTCAATAAAAGTT
GCTTTTCAAAAAAAAAAAAAAAAAAAAAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_001014431.1 unedited
AAGCGACTCTGGTGGCTTCTAATGGCCTGCAGCCGGGATTCGTCGACTGGATCCGGTACC
GAGGAGATCTGCCGCCGCGATCGCGGCGCGCCAGATCTCAAGCTTAACTAGTTAGCGGAC
CGACGCGTTAAGCGGCCGCGAATTCAGATCCACAAGTTTGTACAAAAAAGCAGGCTTGTA
AAACGACGGCCAGTAACTATAACGGTCCTAAGGTAGCGAGGCCTGGGTGGCGAATTCGGC
ACGAGGGGCGGCCGAGCACCGAGCGCTGGGCACCGGGCACCGAGCGGCGGCGGCACGCGA
GGCCCGGCCCCGAGCAGCGCCCCCGCCCGCCGCGGCCTCCAGCCCGGCCCCGCCCAGCGC
CGGCCCGCGGGGATGCGGAGCGGCGGGCGCCGGAGGCCGCGGCCCGGCTAGGCCCGCGCT
CGCGCCCGGACGCGGCGGCCCGAGGCTGTGGCCAGGCCAGCTGGGCTCGGGGAGCGCCAG
CCTGAGAGGAGCGCGTGAGCGTCGCGGGAGCCTCGGGCACCATGAGCGACGTGGCTATTG
TGAAGGAGGGTTGGCTGCACAAACGAGGGGAGTACATCAAGACCTGGCGGCCACGCTACT
TCCTCCTCAAGAATGATGGCACCTTCATTGGCTACAAGGAGCGGCCGCAGGATGTGGACC
AACGTGAGGCTCCCCTCAACAACTTCTCTGTGGCGCAGTGCCAGCTGATGAAGACGGAGC
GGCCCCCGGCCCAACACCTTCATCATCCGCTGCCTGCAGTGGACCACTGTCATCGAACGC
ACCTTCCATGTGGAGACTCCTGAGGAGCGGGAGGAGTGGACAACCCGCCATCCAGACTGT
GGCCTGACGGCCTCAGAGCAAGAGAAGGAGAGATGGGACTTCCGTCGGGCTCACCCAGTT
GACACTCAGGGCTGAGAGATTGGGAGGGTGTCCCTGGCCCAGGCCAAGCACCGGC
Restriction Sites Please inquire     
Tag Tag Free
ACCN NM_001014431
ORF Size 1443 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001014431.1, NP_001014431
RefSeq Size 2794
RefSeq ORF 1443
Locus ID 207
Cytogenetics 14q32.33
Protein Families Protein Kinase, ES Cell Differentiation/IPS, Druggable Genome
Protein Pathways MAPK signaling pathway, ErbB signaling pathway, Chemokine signaling pathway, mTOR signaling pathway, Apoptosis, VEGF signaling pathway, Focal adhesion, Tight junction, Toll-like receptor signaling pathway, Jak-STAT signaling pathway, T cell receptor signaling pathway, B cell receptor signaling pathway, Fc epsilon RI signaling pathway, Fc gamma R-mediated phagocytosis, Neurotrophin signaling pathway, Insulin signaling pathway, Progesterone-mediated oocyte maturation, Adipocytokine signaling pathway, Pathways in cancer, Colorectal cancer, Renal cell carcinoma, Pancreatic cancer, Endometrial cancer, Glioma, Prostate cancer, Melanoma, Chronic myeloid leukemia, Acute myeloid leukemia, Small cell lung cancer, Non-small cell lung cancer
Gene Summary The serine-threonine protein kinase encoded by the AKT1 gene is catalytically inactive in serum-starved primary and immortalized fibroblasts. AKT1 and the related AKT2 are activated by platelet-derived growth factor. The activation is rapid and specific, and it is abrogated by mutations in the pleckstrin homology domain of AKT1. It was shown that the activation occurs through phosphatidylinositol 3-kinase. In the developing nervous system AKT is a critical mediator of growth factor-induced neuronal survival. Survival factors can suppress apoptosis in a transcription-independent manner by activating the serine/threonine kinase AKT1, which then phosphorylates and inactivates components of the apoptotic machinery. Mutations in this gene have been associated with the Proteus syndrome. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2011].
Transcript Variant: This variant (3) lacks the 5' exon, but has an upstream alternate 5' exon, as compared to variant 1. Variants 1 and 3 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations