67kDa Laminin Receptor (RPSA) (NM_002295) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | 67kDa Laminin Receptor |
Synonyms | 37LRP; 67LR; ICAS; LAMBR; lamR; LAMR1; LBP; LBP/p40; LRP; LRP/LR; NEM/1CHD4; p40; SA |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
Fully Sequenced ORF
>OriGene sequence for NM_002295.4
CTTTTCCGTGCTACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGATTCCCGTCGTAACT
TAAAAGGAAATTTTCACAATGTCCGGAGCCCTTGATGTCCTGCAAATGAAGGAGGAGGAT GTCCTTAAGTTCCTTGCAGCAGGAACCCACTTAGGTGGCACCAATCTTGACTTCCAGATG GAACAGTACATCTATAAAAGGAAAAGTGATGGCATCTATATCATAAATCTCAAGAGGACC TGGGAGAAGCTTCTGCTGGCAGCTCGTGCAATTGTTGCCATTGAAAACCCTGCTGATGTC AGTGTTATATCCTCCAGGAATACTGGCCAGAGGGCTGTGCTGAAGTTTGCTGCTGCCACT GGAGCCACTCCAATTGCTGGCCGCTTCACTCCTGGAACCTTCACTAACCAGATCCAGGCA GCCTTCCGGGAGCCACGGCTTCTTGTGGTTACTGACCCCAGGGCTGACCACCAGCCTCTC ACGGAGGCATCTTATGTTAACCTACCTACCATTGCGCTGTGTAACACAGATTCTCCTCTG CGCTATGTGGACATTGCCATCCCATGCAACAACAAGGGAGCTCACTCAGTGGGTTTGATG TGGTGGATGCTGGCTCGGGAAGTTCTGCGCATGCGTGGCACCATTTCCCGTGAACACCCA TGGGAGGTCATGCCTGATCTGTACTTCTACAGAGATCCTGAAGAGATTGAAAAAGAAGGG CAGGCTGCTGCTGAGAAGGCAGTGACCAAGGAGGAATTTCAGGGTGAATGGACTGCTCCC GCTCCTGAGTTCACTGCTACTCAGCCTGAGGTTGCAGACTGGTCTGAAGGTGTACAGGTG CCCTCTGTGCCTATTCAGCAATTCCCTACTGAAGACTGGAGCGCTCAGCCTGCCACGGAA GACTGGTCTGCAGCTCCCACTGCTCAGGCCACTGAATGGGTAGGAGCAACCACTGACTGG TCTTAAGCTGTTCTTGCATAGGCTCTTAAGCAGCATGGAAAAATGGTTGATGGAAAATAA ACATCAGTTTCTAAAAGTTGTCTTCAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_002295 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_002295.4, NP_002286.2 |
RefSeq Size | 1155 bp |
RefSeq ORF | 888 bp |
Locus ID | 3921 |
UniProt ID | P08865 |
Cytogenetics | 3p22.1 |
Domains | Ribosomal_S2 |
Protein Families | Druggable Genome |
Protein Pathways | Ribosome |
Summary | Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Many of the effects of laminin are mediated through interactions with cell surface receptors. These receptors include members of the integrin family, as well as non-integrin laminin-binding proteins. This gene encodes a high-affinity, non-integrin family, laminin receptor 1. This receptor has been variously called 67 kD laminin receptor, 37 kD laminin receptor precursor (37LRP) and p40 ribosome-associated protein. The amino acid sequence of laminin receptor 1 is highly conserved through evolution, suggesting a key biological function. It has been observed that the level of the laminin receptor transcript is higher in colon carcinoma tissue and lung cancer cell line than their normal counterparts. Also, there is a correlation between the upregulation of this polypeptide in cancer cells and their invasive and metastatic phenotype. Multiple copies of this gene exist, however, most of them are pseudogenes thought to have arisen from retropositional events. Two alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) represents the shorter transcript and encodes the shorter isoform (1). |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC209795 | RPSA (Myc-DDK-tagged)-Human ribosomal protein SA (RPSA), transcript variant 1 | 10 ug |
$300.00
|
|
RC209795L1 | Lenti ORF clone of Human ribosomal protein SA (RPSA), transcript variant 1, Myc-DDK-tagged | 10 ug |
$600.00
|
|
RC209795L2 | Lenti ORF clone of Human ribosomal protein SA (RPSA), transcript variant 1, mGFP tagged | 10 ug |
$600.00
|
|
RC209795L3 | Lenti ORF clone of Human ribosomal protein SA (RPSA), transcript variant 1, Myc-DDK-tagged | 10 ug |
$600.00
|
|
RC209795L4 | Lenti ORF clone of Human ribosomal protein SA (RPSA), transcript variant 1, mGFP tagged | 10 ug |
$600.00
|
|
RG209795 | RPSA (tGFP-tagged) - Human ribosomal protein SA (RPSA), transcript variant 1 | 10 ug |
$489.00
MSRP
$500.00
MSRP
$500.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.