OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

MDH2 (NM_005918) Human Untagged Clone

Be the first to review this product
SKU
SC320052
MDH2 (untagged)-Human malate dehydrogenase 2, NAD (mitochondrial) (MDH2), nuclear gene encoding mitochondrial protein
  $457.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA308153 Rabbit Polyclonal antibody to MDH2 (malate dehydrogenase 2, NAD (mitochondrial))
100 ul
$665.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "MDH2 or NM_005918"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol MDH2
Synonyms DEE51; EIEE51; M-MDH; MDH; MGC:3559; MOR1
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_005918.2 GCCAGTCGGTGCCCCTCCCGCTCCAGCCATGCTCTCCGCCCTCGCCCGGCCTGTCAGCGC
TGCTCTCCGCCGCAGCTTCAGCACCTCGGCCCAGAACAATGCTAAAGTAGCTGTGCTAGG
GGCCTCTGGAGGCATCGGGCAGCCACTTTCACTTCTCCTGAAGAACAGCCCCTTGGTGAG
CCGCCTGACCCTCTATGATATCGCGCACACACCCGGAGTGGCCGCAGATCTGAGCCACAT
CGAGACCAAAGCCGCTGTGAAAGGCTACCTCGGACCTGAACAGCTGCCTGACTGCCTGAA
AGGTTGTGATGTGGTAGTTATTCCGGCTGGAGTCCCCAGAAAGCCAGGCATGACCCGGGA
CGACCTGTTCAACACCAATGCCACGATTGTGGCCACCCTGACCGCTGCCTGTGCCCAGCA
CTGCCCGGAAGCCATGATCTGCGTCATTGCCAATCCGGTTAATTCCACCATCCCCATCAC
AGCAGAAGTTTTCAAGAAGCATGGAGTGTACAACCCCAACAAAATCTTCGGCGTGACGAC
CCTGGACATCGTCAGAGCCAACACCTTTGTTGCAGAGCTGAAGGGTTTGGATCCAGCTCG
AGTCAACGTCCCTGTCATTGGTGGCCATGCTGGGAAGACCATCATCCCCCTGATCTCTCA
GTGCACCCCCAAGGTGGACTTTCCCCAGGACCAGCTGACAGCACTCACTGGGCGGATCCA
GGAGGCCGGCACGGAGGTGGTCAAGGCTAAAGCCGGAGCAGGCTCTGCCACCCTCTCCAT
GGCGTATGCCGGCGCCCGCTTTGTCTTCTCCCTTGTGGATGCAATGAATGGAAAGGAAGG
TGTTGTGGAATGTTCCTTCGTTAAGTCACAGGAAACGGAATGTACCTACTTCTCCACACC
GCTGCTGCTTGGGAAAAAGGGCATCGAGAAGAACCTGGGCATCGGCAAAGTCTCCTCTTT
TGAGGAGAAGATGATCTCGGATGCCATCCCCGAGCTGAAGGCCTCCATCAAGAAGGGGGA
AGATTTCGTGAAGACCCTGAAGTGAGCCGCTGTGACGGGTGGCCAGTTTCCTTAATTTAT
GAAGGCATCATGTCACTGCAAAGCCGTTGCAGATAAACTTTGTATTTTAATTTGCTTTGG
TGATGATTACTGTATTGACATCATCATGCCTTCCAAATTGTGGGTGGCTCTGTGGGCGCA
TCAATAAAAGCCGTCCTTGATTTTAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire |
ACCN NM_005918
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_005918.2, NP_005909.2
RefSeq Size 1321 bp
RefSeq ORF 1017 bp
Locus ID 4191
UniProt ID P40926
Cytogenetics 7q11.23
Domains ldh
Protein Families Druggable Genome
Protein Pathways Citrate cycle (TCA cycle), Glyoxylate and dicarboxylate metabolism, Metabolic pathways, Pyruvate metabolism
Summary Malate dehydrogenase catalyzes the reversible oxidation of malate to oxaloacetate, utilizing the NAD/NADH cofactor system in the citric acid cycle. The protein encoded by this gene is localized to the mitochondria and may play pivotal roles in the malate-aspartate shuttle that operates in the metabolic coordination between cytosol and mitochondria. Several transcript variants encoding different isoforms have been found for this gene. provided by RefSeq, Sep 2013
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1).
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_005918" in other vectors (6)
SKU Description Size Price
RC201095 MDH2 (Myc-DDK-tagged)-Human malate dehydrogenase 2, NAD (mitochondrial) (MDH2), nuclear gene encoding mitochondrial protein 10 ug
$457.00
RC201095L1 Lenti ORF clone of Human malate dehydrogenase 2, NAD (mitochondrial) (MDH2), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged 10 ug
$757.00
RC201095L2 Lenti ORF clone of Human malate dehydrogenase 2, NAD (mitochondrial) (MDH2), nuclear gene encoding mitochondrial protein, mGFP tagged 10 ug
$757.00
RC201095L3 Lenti ORF clone of Human malate dehydrogenase 2, NAD (mitochondrial) (MDH2), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged 10 ug
$757.00
RC201095L4 Lenti ORF clone of Human malate dehydrogenase 2, NAD (mitochondrial) (MDH2), nuclear gene encoding mitochondrial protein, mGFP tagged 10 ug
$757.00
RG201095 MDH2 (tGFP-tagged) - Human malate dehydrogenase 2, NAD (mitochondrial) (MDH2), nuclear gene encoding mitochondrial protein 10 ug
$489.00 $657.00

file-alt Citations

Whole-Exome Sequencing Identifies MDH2 as a New Familial Paraganglioma Gene
Cascón, Comino-Méndez, Currás-Freixes et al
J. Natl. Cancer Inst. (2015) 107 (5) DOI: 10.1093/jnci/djv053
Cited by 192
AI Summary: OriGene’s pCMV6-AC-MDH2 plasmid, containing the full human MDH2 cDNA, was used to restore MDH2 expression in knockdown HeLa cells, demonstrating the functional impact of the identified MDH2 mutation in familial paraganglioma.
Snippet: F) Western blot of MDH2 KD HeLa cells transfected with a plasmid containing the full cDNA sequence of the human MDH2 gene (pCMV6-AC-MDH2;Origene), compared with MDH2 KD cells transfected with empty vector (EV) and with untransfected WT HeLa cells. ... Cite SaveSaving
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products