AKIP (AURKAIP1) (NM_017900) Human Untagged Clone

SKU
SC319945
AURKAIP1 (untagged)-Human aurora kinase A interacting protein 1 (AURKAIP1), transcript variant 1
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol AKIP
Synonyms AIP; AKIP; MRP-S38
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_017900.1 CGGAAGTGCCCGAGGGCGGCCGCAGAACGGTCAATTTGAGCCGCGTCGAGCTCCCCTGGG
ACCTGTGGCCGCCGCCCACAGACCATGCTCCTGGGGCGCCTGACTTCCCAGCTGTTGAGG
GCCGTTCCTTGGGCAGGCGGCCGCCCGCCTTGGCCCGTCTCTGGAGTGCTGGGCAGCCGG
GTCTGCGGGCCCCTTTACAGCACATCGCCGGCCGGCCCAGGTAGGGCGGCCTCTCTCCCT
CGCAAGGGGGCCCAGCTGGAGCTGGAGGAGATGCTGGTCCCCAGGAAGATGTCCGTCAGC
CCCCTGGAGAGCTGGCTCACGGCCCGCTGCTTCCTGCCCAGACTGGATACCGGGACCGCA
GGGACTGTGGCTCCACCGCAATCCTACCAGTGTCCGCCCAGCCAGATAGGGGAAGGGGCC
GAGCAGGGGGATGAAGGCGTCGCGGATGCGCCTCAAATTCAGTGCAAAAACGTGCTGAAG
ATCCGCCGGCGGAAGATGAACCACCACAAGTACCGGAAGCTGGTGAAGAAGACGCGGTTC
CTGCGGAGGAAGGTCCAGGAGGGACGCCTGAGACGCAAGCAGATCAAGTTCGAGAAAGAC
CTGAGGCGCATCTGGCTGAAGGCGGGGCTAAAGGAAGCCCCCGAAGGCTGGCAGACCCCC
AAGATCTACCTGCGGGGCAAATGAGTCTGGCGCCGCCCTTCCCGCCCGTTGCTGCTGTGA
TCCGTAGTAATAAATTCTCAGAGGACTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAA
Restriction Sites Please inquire
ACCN NM_017900
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_017900.1, NP_060370.1
RefSeq Size 794 bp
RefSeq ORF 600 bp
Locus ID 54998
UniProt ID Q9NWT8
Cytogenetics 1p36.33
Protein Families Druggable Genome
Summary May act as a negative regulator of Aurora-A kinase, by down-regulation through proteasome-dependent degradation.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) has a 5'UTR resulting from use of an alternate splice donor site.
Write Your Own Review
You're reviewing:AKIP (AURKAIP1) (NM_017900) Human Untagged Clone
Your Rating
SKU Description Size Price
RC209130 AURKAIP1 (Myc-DDK-tagged)-Human aurora kinase A interacting protein 1 (AURKAIP1), transcript variant 1 10 ug
$300.00
RC209130L3 Lenti ORF clone of Human aurora kinase A interacting protein 1 (AURKAIP1), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC209130L4 Lenti ORF clone of Human aurora kinase A interacting protein 1 (AURKAIP1), transcript variant 1, mGFP tagged 10 ug
$600.00
RG209130 AURKAIP1 (tGFP-tagged) - Human aurora kinase A interacting protein 1 (AURKAIP1), transcript variant 1 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.