MAST4 (NM_198828) Human Untagged Clone

SKU
SC319866
MAST4 (untagged)-Human microtubule associated serine/threonine kinase family member 4 (MAST4), transcript variant 2
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol MAST4
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_198828.1 GCAGCGCGGGAGCACAGTGGAGCGCAGATCGCGGACCCGAGCGGGCATGTCCCCGCGCGC
GGGAGCCTCCGTTTGCGGCCGGGCCCGGGCGGCTGTGAACTTAGCAGCGGGCTCCTGCGG
CCCCGTCACTGCCATGTAGTCGCTGGCGGGGCTCCCTGCAGCCCGGGAGCGGCAGTGCCA
GTGAGCCTGAGCCCAGGAGCCCGCGTCTTCCCCGGGAGGCGCTGAGTGCGCGCCGCGCCC
CCGCCGCTCGGGAGGCACTTTGGGCCAGACAGGGAAATGGGGGAGAAAGTTTCGGAGGCG
CCAGAGCCGGTGCCCCGCGGCTGCAGTGGCCACGGCAGCCGGACTCCAGCCTCTGCGCTG
GTCGCCGCGTCCTCTCCGGGTGCTTCCTCGGCCGAGTCCTCCTCGGGCTCAGAAACTCTG
TCGGAGGAAGGGGAGCCCGGCGGCTTCTCCAGAGAGCATCAGCCGCCGCCGCCGCCGCCG
TTGGGAGGCACCCTGGGCGCCCGGGCGCCCGCCGCGTGGGCTCCGGCAAGCGTGCTGCTG
GAGCGCGGAGTCCTTGCGCTGCCGCCGCCGCTTCCCGGAGGAGCTGTGCCGCCCGCGCCC
CGGGGCAGCAGCGCGTCCCAGGAGGAGCAGGACGAGGAGCTTGACCACATATTATCCCCT
CCACCCATGCCGTTTCGGAAATGCAGCAACCCAGATGTGGCTTCTGGCCCTGGAAAATCA
CTGAAGTATAAAAGACAGCTGAGTGAGGATGGAAGACAGCTAAGGCGAGGGAGCCTGGGA
GGAGCCCTGACTGGGAGGTACCTTCTTCCAAACCCGGTGGCGGGACAGGCCTGGCCGGCC
TCTGCAGAGACGTCCAACCTCGTGCGCATGCGCAGCCAGGCCCTGGGCCAGTCGGCGCCC
TCGCTCACCGCCAGCCTGAAGGAGCTGAGTCTCCCCAGAAGAGGAAGTTTGATAGATTCC
CAGAAGTGGAATTGCTTGGTCAAACGCCCTGTGTGTCCAAATGCTGGGAGAACATCACCC
CTTGGATGAATTGCCACCACATTAAATAAAACATATCCAAAGCTCAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire
ACCN NM_198828
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_198828.1, NP_942123.1
RefSeq Size 1105 bp
RefSeq ORF 753 bp
Locus ID 375449
UniProt ID O15021
Cytogenetics 5q12.3
Protein Families Druggable Genome, Protein Kinase
Summary This gene encodes a member of the microtubule-associated serine/threonine protein kinases. The proteins in this family contain a domain that gives the kinase the ability to determine its own scaffold to control the effects of their kinase activities. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
Transcript Variant: This variant (2) uses a distinct 3' coding region and 3' UTR, compared to variant 3. The resulting isoform (b) has a substantially shorter and distinct C-terminus, compared to isoform c.
Write Your Own Review
You're reviewing:MAST4 (NM_198828) Human Untagged Clone
Your Rating
SKU Description Size Price
RC207706 MAST4 (Myc-DDK-tagged)-Human microtubule associated serine/threonine kinase family member 4 (MAST4), transcript variant 2 10 ug
$300.00
RC207706L1 Lenti ORF clone of Human microtubule associated serine/threonine kinase family member 4 (MAST4), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC207706L2 Lenti ORF clone of Human microtubule associated serine/threonine kinase family member 4 (MAST4), transcript variant 2, mGFP tagged 10 ug
$600.00
RC207706L3 Lenti ORF clone of Human microtubule associated serine/threonine kinase family member 4 (MAST4), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC207706L4 Lenti ORF clone of Human microtubule associated serine/threonine kinase family member 4 (MAST4), transcript variant 2, mGFP tagged 10 ug
$600.00
RG207706 MAST4 (tGFP-tagged) - Human microtubule associated serine/threonine kinase family member 4 (MAST4), transcript variant 2 10 ug
$500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.