DHLAG (CD74) (NM_001025158) Human Untagged Clone
CAT#: SC319577
CD74 (untagged)-Human CD74 molecule, major histocompatibility complex, class II invariant chain (CD74), transcript variant 3
"NM_001025158" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | DHLAG |
Synonyms | DHLAG; HLADG; Ia-GAMMA; II; p33 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_001025158.1
CCGGGGGGTCAGGGTCCCAGATGCACAGGAGGAGAAGCAGGAGCTGTCGGGAAGATCAGA
AGCCAGTCATGGATGACCAGCGCGACCTTATCTCCAACAATGAGCAACTGCCCATGCTGG GCCGGCGCCCTGGGGCCCCGGAGAGCAAGTGCAGCCGCGGAGCCCTGTACACAGGCTTTT CCATCCTGGTGACTCTGCTCCTCGCTGGCCAGGCCACCACCGCCTACTTCCTGTACCAGC AGCAGGGCCGGCTGGACAAACTGACAGTCACCTCCCAGAACCTGCAGCTGGAGAACCTGC GCATGAAGCTTCCCAAGCCTCCCAAGCCTGTGAGCAAGATGCGCATGGCCACCCCGCTGC TGATGCAGGCGCTGCCCATGGGAGCCCTGCCCCAGGGGCCCATGCAGAATGCCACCAAGT ATGGCAACATGACAGAGGACCATGTGATGCACCTGCTCCAGAGTCACTGGAACTGGAGGA CCCGTCTTCTGGGCTGGGTGTGACCAAGCAGGATCTGGGCCCAGTCCCCATGTGAGAGCA GCAGAGGCGGTCTTCAACATCCTGCCAGCCCCACACAGCTACAGCTTTCTTGCTCCCTTC AGCCCCCAGCCCCTCCCCCATCTCCCACCCTGTACCTCATCCCATGAGACCCTGGTGCCT GGCTCTTTCGTCACCCTTGGACAAGACAAACCAAGTCGGAACAGCAGATAACAATGCAGC AAGGCCCTGCTGCCCAATCTCCATCTGTCAACAGGGGCGTGAGGTCCCAGGAAGTGGCCA AAAGCTAGACAGATCCCCGTTCCTGACATCACAGCAGCCTCCAACACAAGGCTCCAAGAC CTAGGCTCATGGACGAGATGGGAAGGCACAGGGAGAAGGGATAACCCTACACCCAGACCC CAGGCTGGACATGCTGACTGTCCTCTCCCCTCCAGCCTTTGGCCTTGGCTTTTCTAGCCT ATTTACCTGCAGGCTGAGCCACTCTCTTCCCTTTCCCCAGCATCACTCCCCAAGGAAGAG CCAATGTTTTCCACCCATAATCCTTTCTGCCGACCCCTAGTTCCCTCTGCTCAGCCAAGC TTGTTATCAGCTTTCAGGGCCATGGTTCACATTAGAATAAAAGGTAGTAATTAGAACAAA AAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_001025158 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001025158.1, NP_001020329.1 |
RefSeq Size | 1155 bp |
RefSeq ORF | 483 bp |
Locus ID | 972 |
UniProt ID | P04233 |
Cytogenetics | 5q33.1 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Antigen processing and presentation |
Gene Summary | The protein encoded by this gene associates with class II major histocompatibility complex (MHC) and is an important chaperone that regulates antigen presentation for immune response. It also serves as cell surface receptor for the cytokine macrophage migration inhibitory factor (MIF) which, when bound to the encoded protein, initiates survival pathways and cell proliferation. This protein also interacts with amyloid precursor protein (APP) and suppresses the production of amyloid beta (Abeta). Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011] Transcript Variant: This variant (3) lacks three consecutive exons in the 3' coding region, which results in a frame-shift, compared to variant 1. The resulting isoform (c) has a shorter and distinct C-terminus, compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC206830 | CD74 (Myc-DDK-tagged)-Human CD74 molecule, major histocompatibility complex, class II invariant chain (CD74), transcript variant 3 |
USD 150.00 |
|
RC206830L1 | Lenti ORF clone of Human CD74 molecule, major histocompatibility complex, class II invariant chain (CD74), transcript variant 3, Myc-DDK-tagged |
USD 450.00 |
|
RC206830L2 | Lenti ORF clone of Human CD74 molecule, major histocompatibility complex, class II invariant chain (CD74), transcript variant 3, mGFP tagged |
USD 450.00 |
|
RC206830L3 | Lenti ORF clone of Human CD74 molecule, major histocompatibility complex, class II invariant chain (CD74), transcript variant 3, Myc-DDK-tagged |
USD 450.00 |
|
RC206830L4 | Lenti ORF clone of Human CD74 molecule, major histocompatibility complex, class II invariant chain (CD74), transcript variant 3, mGFP tagged |
USD 450.00 |
|
RG206830 | CD74 (tGFP-tagged) - Human CD74 molecule, major histocompatibility complex, class II invariant chain (CD74), transcript variant 3 |
USD 350.00 |
{0} Product Review(s)
Be the first one to submit a review