DHLAG (CD74) (NM_001025158) Human Untagged Clone

CAT#: SC319577

CD74 (untagged)-Human CD74 molecule, major histocompatibility complex, class II invariant chain (CD74), transcript variant 3


  "NM_001025158" in other vectors (6)

Reconstitution Protocol

USD 150.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
CD74 mouse monoclonal antibody, clone OTI1H3 (formerly 1H3)
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "DHLAG"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol DHLAG
Synonyms DHLAG; HLADG; Ia-GAMMA; II; p33
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_001025158.1 CCGGGGGGTCAGGGTCCCAGATGCACAGGAGGAGAAGCAGGAGCTGTCGGGAAGATCAGA
AGCCAGTCATGGATGACCAGCGCGACCTTATCTCCAACAATGAGCAACTGCCCATGCTGG
GCCGGCGCCCTGGGGCCCCGGAGAGCAAGTGCAGCCGCGGAGCCCTGTACACAGGCTTTT
CCATCCTGGTGACTCTGCTCCTCGCTGGCCAGGCCACCACCGCCTACTTCCTGTACCAGC
AGCAGGGCCGGCTGGACAAACTGACAGTCACCTCCCAGAACCTGCAGCTGGAGAACCTGC
GCATGAAGCTTCCCAAGCCTCCCAAGCCTGTGAGCAAGATGCGCATGGCCACCCCGCTGC
TGATGCAGGCGCTGCCCATGGGAGCCCTGCCCCAGGGGCCCATGCAGAATGCCACCAAGT
ATGGCAACATGACAGAGGACCATGTGATGCACCTGCTCCAGAGTCACTGGAACTGGAGGA
CCCGTCTTCTGGGCTGGGTGTGACCAAGCAGGATCTGGGCCCAGTCCCCATGTGAGAGCA
GCAGAGGCGGTCTTCAACATCCTGCCAGCCCCACACAGCTACAGCTTTCTTGCTCCCTTC
AGCCCCCAGCCCCTCCCCCATCTCCCACCCTGTACCTCATCCCATGAGACCCTGGTGCCT
GGCTCTTTCGTCACCCTTGGACAAGACAAACCAAGTCGGAACAGCAGATAACAATGCAGC
AAGGCCCTGCTGCCCAATCTCCATCTGTCAACAGGGGCGTGAGGTCCCAGGAAGTGGCCA
AAAGCTAGACAGATCCCCGTTCCTGACATCACAGCAGCCTCCAACACAAGGCTCCAAGAC
CTAGGCTCATGGACGAGATGGGAAGGCACAGGGAGAAGGGATAACCCTACACCCAGACCC
CAGGCTGGACATGCTGACTGTCCTCTCCCCTCCAGCCTTTGGCCTTGGCTTTTCTAGCCT
ATTTACCTGCAGGCTGAGCCACTCTCTTCCCTTTCCCCAGCATCACTCCCCAAGGAAGAG
CCAATGTTTTCCACCCATAATCCTTTCTGCCGACCCCTAGTTCCCTCTGCTCAGCCAAGC
TTGTTATCAGCTTTCAGGGCCATGGTTCACATTAGAATAAAAGGTAGTAATTAGAACAAA
AAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_001025158
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001025158.1, NP_001020329.1
RefSeq Size 1155 bp
RefSeq ORF 483 bp
Locus ID 972
UniProt ID P04233
Cytogenetics 5q33.1
Protein Families Druggable Genome, Transmembrane
Protein Pathways Antigen processing and presentation
Gene Summary The protein encoded by this gene associates with class II major histocompatibility complex (MHC) and is an important chaperone that regulates antigen presentation for immune response. It also serves as cell surface receptor for the cytokine macrophage migration inhibitory factor (MIF) which, when bound to the encoded protein, initiates survival pathways and cell proliferation. This protein also interacts with amyloid precursor protein (APP) and suppresses the production of amyloid beta (Abeta). Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]
Transcript Variant: This variant (3) lacks three consecutive exons in the 3' coding region, which results in a frame-shift, compared to variant 1. The resulting isoform (c) has a shorter and distinct C-terminus, compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.