CEBP Beta(CEBPB) (NM_005194) Human Untagged Clone

CAT#: SC319561

CEBPB (untagged)-Human CCAAT/enhancer binding protein (C/EBP), beta (CEBPB)

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name CEBP Beta(CEBPB) (NM_005194) Human Untagged Clone
Symbol CEBPB
Synonyms C/EBP-beta; IL6DBP; NF-IL6; TCF5
Vector pCMV6-AC
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_005194.2 GAGCCGCGCACGGGACTGGGAAGGGGACCCACCCGAGGGTCCAGCCACCAGCCCCCTCAC
TAATAGCGGCCACCCCGGCAGCGGCGGCAGCAGCAGCAGCGACGCAGCGGCGACAGCTCA
GAGCAGGGAGGCCGCGCCACCTGCGGGCCGGCCGGAGCGGGCAGCCCCAGGCCCCCTCCC
CGGGCACCCGCGTTCATGCAACGCCTGGTGGCCTGGGACCCAGCATGTCTCCCCCTGCCG
CCGCCGCCGCCTGCCTTTAAATCCATGGAAGTGGCCAACTTCTACTACGAGGCGGACTGC
TTGGCTGCTGCGTACGGCGGCAAGGCGGCCCCCGCGGCGCCCCCCGCGGCCAGACCCGGG
CCGCGCCCCCCCGCCGGCGAGCTGGGCAGCATCGGCGACCACGAGCGCGCCATCGACTTC
AGCCCGTACCTGGAGCCGCTGGGCGCGCCGCAGGCCCCGGCGCCCGCCACGGCCACGGAC
ACCTTCGAGGCGGCTCCGCCCGCGCCCGCCCCCGCGCCCGCCTCCTCCGGGCAGCACCAC
GACTTCCTCTCCGACCTCTTCTCCGACGACTACGGGGGCAAGAACTGCAAGAAGCCGGCC
GAGTACGGCTACGTGAGCCTGGGGCGCCTGGGGGCTGCCAAGGGCGCGCTGCACCCCGGC
TGCTTCGCGCCCCTGCACCCACCGCCCCCGCCGCCGCCGCCGCCCGCCGAGCTCAAGGCG
GAGCCGGGCTTCGAGCCCGCGGACTGCAAGCGGAAGGAGGAGGCCGGGGCGCCGGGCGGC
GGCGCAGGCATGGCGGCGGGCTTCCCGTACGCGCTGCGCGCTTACCTCGGCTACCAGGCG
GTGCCGAGCGGCAGCAGCGGGAGCCTCTCCACGTCCTCCTCGTCCAGCCCGCCCGGCACG
CCGAGCCCCGCTGACGCCAAGGCGCCCCCGACCGCCTGCTACGCGGGGGCCGCGCCGGCG
CCCTCGCAGGTCAAGAGCAAGGCCAAGAAGACCGTGGACAAGCACAGCGACGAGTACAAG
ATCCGGCGCGAGCGCAACAACATCGCCGTGCGCAAGAGCCGCGACAAGGCCAAGATGCGC
AACCTGGAGACGCAGCACAAGGTCCTGGAGCTCACGGCCGAGAACGAGCGGCTGCAGAAG
AAGGTGGAGCAGCTGTCGCGCGAGCTCAGCACCCTGCGGAACTTGTTCAAGCAGCTGCCC
GAGCCCCTGCTCGCCTCCTCCGGCCACTGCTAGCGCGGCCCCCGCGCGCGTCCCCCTGCC
GGCCGGGGCTGAGACTCCGGGGAGCGCCCGCGCCCGCGCCCTCGCCCCCGCCCCCGGCGG
CGCCGGCAAAACTTTGGCACTGGGGCACTTGGCAGCGCGGGGAGCCCGTCGGTAATTTTA
ATATTTTATTATATATATATATCTATATTTTTGTCCAAACCAACCGCACATGCAGATGGG
GCTCCCGCCCGTGGTGTTATTTAAAGAAGAAACGTCTATGTGTACAGATGAATGATAAAC
TCTCTGCTTCTCCCTCTGCCCCTCTCCAGGCGCCGGCGGGCGGGCCGGTTTCGAAGTTGA
TGCAATCGGTTTAAACATGGCTGAACGCGTGTGTACACGGGACTGACGCAACCCACGTGT
AACTGTCAGCCGGGCCCTGAGTAATCGCTTAAAGATGTTCCTACGGGCTTGTTGCTGTTG
ATGTTTTGTTTTGTTTTGTTTTTTGGTCTTTTTTTGTATTATAAAAAATAATCTATTTCT
ATGAGAAAAGAGGCGTCTGTATATTTTGGGAATCTTTTCCGTTTCAAGCATTAAGAACAC
TTTTAATAAACTTTTTTTTGAGAATGGTTAAAAAAAAAAAAAAAAAAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_005194.2 unedited
GGGGTACTATTGTATACGACTCCTATAGGGCGGCCGGGAATTCGGCACGAGGGAGCCGCG
CACGGGACTGGGAAGGGGACCCACCCGAGGGTCCAGCCACCAGCCCCCTCACTAATAGCG
GCCACCCCGGCAGCGGCGGCAGCAGCAGCAGCGACGCAGCGGCGACAGCTCAGAGCAGGG
AGGCCGCGCCACCTGCGGGCCGGCCGGAGCGGGCAGCCCCAGGCCCCCTCCCCGGGCACC
CGCGTTCATGCAACGCCTGGTGGCCTGGGACCCAGCATGTCTCCCCCTGCCGCCGCCGCC
GCCTGCCTTTAAATCCATGGAAGTGGCCAACTTCTACTACGAGGCGGACTGCTTGGCTGC
TGCGTACGGCGGCAAGGCGGCCCCCGCGGCGCCCCCCGCGGCCAGACCCGGGCCGCGCCC
CCCCGCCGGCGAGCTGGGCAGCATCGGCGACCACGAGCGCGCCATCGACTTCAGCCCGTA
CCTGGAGCCGCTGGGCGCGCCGCAGGCCCCGGCGCCCGCCACGGCCACGGACACCTTCGA
GGCGGCTCCGCCCGCGCCCGCCCCCGCGCCCGCCTCCTCCGGGCAGCACCACGACTTCCT
CTCCGACCTCTTCTCCGACGACTACGGGGGCAAGAACTGCAAGAAGCCGGCCGAGTACGG
CTACGTGAGCCTGGGGCGCCTGGGGGCTGCCAAGGGCGCGCTGCACCCCGGCTGCTTCGC
GCCCCTGCACCCACCGACCCCGCGCCGCGCCGCCCGCGAGCTCAGGCGGAGCCCGGGCTT
CGAGCCGCGGACTGAAGCGGAAAGAGAGGCCGGGGCGCC
Restriction Sites Please inquire     
Tag Tag Free
ACCN NM_005194
ORF Size 1038 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_005194.2, NP_005185
RefSeq Size 1837
RefSeq ORF 1038
Locus ID 1051
Cytogenetics 20q13.13
Domains BRLZ
Protein Families ES Cell Differentiation/IPS, Transcription Factors, Druggable Genome
Gene Summary This intronless gene encodes a transcription factor that contains a basic leucine zipper (bZIP) domain. The encoded protein functions as a homodimer but can also form heterodimers with CCAAT/enhancer-binding proteins alpha, delta, and gamma. Activity of this protein is important in the regulation of genes involved in immune and inflammatory responses, among other processes. The use of alternative in-frame AUG start codons results in multiple protein isoforms, each with distinct biological functions. [provided by RefSeq, Oct 2013].
Transcript Variant: This variant (1) encodes multiple isoforms through the use of alternative translation initiation codons. The isoform (a, also known as LAP*) represented in this RefSeq results from translation initiation at the 5' most AUG start codon and is the longest isoform.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations