CEBP Beta (CEBPB) (NM_005194) Human Untagged Clone

CAT#: SC319561

Reviews ()
Write a review

CEBPB (untagged)-Human CCAAT/enhancer binding protein (C/EBP), beta (CEBPB)



  "NM_005194" in other vectors (6)

USD 477.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CEBPB
Synonyms C/EBP-beta; IL6DBP; NF-IL6; TCF5
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_005194.2 GAGCCGCGCACGGGACTGGGAAGGGGACCCACCCGAGGGTCCAGCCACCAGCCCCCTCAC
TAATAGCGGCCACCCCGGCAGCGGCGGCAGCAGCAGCAGCGACGCAGCGGCGACAGCTCA
GAGCAGGGAGGCCGCGCCACCTGCGGGCCGGCCGGAGCGGGCAGCCCCAGGCCCCCTCCC
CGGGCACCCGCGTTCATGCAACGCCTGGTGGCCTGGGACCCAGCATGTCTCCCCCTGCCG
CCGCCGCCGCCTGCCTTTAAATCCATGGAAGTGGCCAACTTCTACTACGAGGCGGACTGC
TTGGCTGCTGCGTACGGCGGCAAGGCGGCCCCCGCGGCGCCCCCCGCGGCCAGACCCGGG
CCGCGCCCCCCCGCCGGCGAGCTGGGCAGCATCGGCGACCACGAGCGCGCCATCGACTTC
AGCCCGTACCTGGAGCCGCTGGGCGCGCCGCAGGCCCCGGCGCCCGCCACGGCCACGGAC
ACCTTCGAGGCGGCTCCGCCCGCGCCCGCCCCCGCGCCCGCCTCCTCCGGGCAGCACCAC
GACTTCCTCTCCGACCTCTTCTCCGACGACTACGGGGGCAAGAACTGCAAGAAGCCGGCC
GAGTACGGCTACGTGAGCCTGGGGCGCCTGGGGGCTGCCAAGGGCGCGCTGCACCCCGGC
TGCTTCGCGCCCCTGCACCCACCGCCCCCGCCGCCGCCGCCGCCCGCCGAGCTCAAGGCG
GAGCCGGGCTTCGAGCCCGCGGACTGCAAGCGGAAGGAGGAGGCCGGGGCGCCGGGCGGC
GGCGCAGGCATGGCGGCGGGCTTCCCGTACGCGCTGCGCGCTTACCTCGGCTACCAGGCG
GTGCCGAGCGGCAGCAGCGGGAGCCTCTCCACGTCCTCCTCGTCCAGCCCGCCCGGCACG
CCGAGCCCCGCTGACGCCAAGGCGCCCCCGACCGCCTGCTACGCGGGGGCCGCGCCGGCG
CCCTCGCAGGTCAAGAGCAAGGCCAAGAAGACCGTGGACAAGCACAGCGACGAGTACAAG
ATCCGGCGCGAGCGCAACAACATCGCCGTGCGCAAGAGCCGCGACAAGGCCAAGATGCGC
AACCTGGAGACGCAGCACAAGGTCCTGGAGCTCACGGCCGAGAACGAGCGGCTGCAGAAG
AAGGTGGAGCAGCTGTCGCGCGAGCTCAGCACCCTGCGGAACTTGTTCAAGCAGCTGCCC
GAGCCCCTGCTCGCCTCCTCCGGCCACTGCTAGCGCGGCCCCCGCGCGCGTCCCCCTGCC
GGCCGGGGCTGAGACTCCGGGGAGCGCCCGCGCCCGCGCCCTCGCCCCCGCCCCCGGCGG
CGCCGGCAAAACTTTGGCACTGGGGCACTTGGCAGCGCGGGGAGCCCGTCGGTAATTTTA
ATATTTTATTATATATATATATCTATATTTTTGTCCAAACCAACCGCACATGCAGATGGG
GCTCCCGCCCGTGGTGTTATTTAAAGAAGAAACGTCTATGTGTACAGATGAATGATAAAC
TCTCTGCTTCTCCCTCTGCCCCTCTCCAGGCGCCGGCGGGCGGGCCGGTTTCGAAGTTGA
TGCAATCGGTTTAAACATGGCTGAACGCGTGTGTACACGGGACTGACGCAACCCACGTGT
AACTGTCAGCCGGGCCCTGAGTAATCGCTTAAAGATGTTCCTACGGGCTTGTTGCTGTTG
ATGTTTTGTTTTGTTTTGTTTTTTGGTCTTTTTTTGTATTATAAAAAATAATCTATTTCT
ATGAGAAAAGAGGCGTCTGTATATTTTGGGAATCTTTTCCGTTTCAAGCATTAAGAACAC
TTTTAATAAACTTTTTTTTGAGAATGGTTAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_005194
Insert Size 1038 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_005194.2, NP_005185.2
RefSeq Size 1837 bp
RefSeq ORF 1038 bp
Locus ID 1051
UniProt ID P17676
Cytogenetics 20q13.13
Domains BRLZ
Protein Families Druggable Genome, ES Cell Differentiation/IPS, Transcription Factors
Gene Summary This intronless gene encodes a transcription factor that contains a basic leucine zipper (bZIP) domain. The encoded protein functions as a homodimer but can also form heterodimers with CCAAT/enhancer-binding proteins alpha, delta, and gamma. Activity of this protein is important in the regulation of genes involved in immune and inflammatory responses, among other processes. The use of alternative in-frame AUG start codons results in multiple protein isoforms, each with distinct biological functions. [provided by RefSeq, Oct 2013]
Transcript Variant: This variant (1) encodes multiple isoforms through the use of alternative translation initiation codons. The isoform (a, also known as LAP*) represented in this RefSeq results from translation initiation at the 5' most AUG start codon and is the longest isoform.

Other Versions

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.