Bif (SH3GLB1) (NM_016009) Human Untagged Clone

SKU
SC319515
SH3GLB1 (untagged)-Human SH3-domain GRB2-like endophilin B1 (SH3GLB1), transcript variant 1
$457.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Bif
Synonyms Bif-1; CGI-61; dJ612B15.2; PPP1R70
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_016009.3 CTCGCCGCCGCTAGGTCGGCCGGCTCCGCCCGGCTGCCGCCTAGGATGAATATCATGGAC
TTCAACGTGAAGAAGCTGGCGGCCGACGCAGGCACCTTCCTCAGTCGCGCCGTGCAGTTC
ACAGAAGAAAAGCTTGGCCAGGCTGAGAAGACAGAATTGGATGCTCACTTAGAGAACCTC
CTTAGCAAAGCTGAATGTACCAAAATATGGACAGAAAAAATAATGAAACAAACTGAAGTG
TTATTGCAGCCAAATCCAAATGCCAGGATAGAAGAATTTGTTTATGAGAAACTGGATAGA
AAAGCTCCAAGTCGTATAAACAACCCAGAACTTTTGGGACAATATATGATTGATGCAGGG
ACTGAGTTTGGCCCAGGAACAGCTTATGGTAATGCCCTTATTAAATGTGGAGAAACCCAA
AAAAGAATTGGAACAGCAGACAGAGAACTGATTCAAACGTCAGCCTTAAATTTTCTTACT
CCTTTAAGAAACTTTATAGAAGGAGATTACAAAACAATTGCTAAAGAAAGGAAACTATTG
CAAAATAAGAGACTGGATTTGGATGCTGCAAAAACGAGACTAAAAAAGGCAAAAGCTGCA
GAAACTAGAAATTCATCTGAACAGGAATTAAGAATAACTCAAAGTGAATTTGATCGTCAA
GCAGAGATTACCAGACTTCTGCTAGAGGGAATCAGCAGTACACATGCCCATCACCTTCGC
TGTCTGAATGACTTTGTAGAAGCCCAGATGACTTACTATGCACAGTGTTACCAGTATATG
TTGGACCTCCAGAAACAACTGGGAAGTTTTCCATCCAATTATCTTAGTAACAACAATCAG
ACTTCTGTGACACCTGTACCATCAGTTTTACCAAATGCGATTGGTTCTTCTGCCATGGCT
TCAACAAGTGGCCTAGTAATCACCTCTCCTTCCAACCTCAGTGACCTTAAGGAGTGTAGT
GGCAGCAGAAAGGCCAGGGTTCTCTATGATTATGATGCAGCAAACAGTACTGAATTATCA
CTTCTGGCAGATGAGGTGATCACTGTGTTCAGTGTTGTTGGAATGGATTCAGACTGGCTA
ATGGGGGAAAGGGGAAACCAGAAGGGCAAGGTGCCAATTACCTACTTAGAACTGCTCAAT
TAAGTAGGTGGACTATGGAAAGGTTGCCCATCATGACTTTGTATTTATATACAATTAACT
CTAAATAAAGCAGGTTAAGTATCTTCAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire
ACCN NM_016009
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_016009.3, NP_057093.1
RefSeq Size 6373 bp
RefSeq ORF 1098 bp
Locus ID 51100
UniProt ID Q9Y371
Cytogenetics 1p22.3
Domains BAR, SH3
Protein Pathways Endocytosis
Summary This gene encodes a SRC homology 3 domain-containing protein. The encoded protein interacts with the proapoptotic member of the Bcl-2 family, Bcl-2-associated X protein (Bax) and may be involved in regulating apoptotic signaling pathways. This protein may also be involved in maintaining mitochondrial morphology. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011]
Transcript Variant: This variant (1) is a predominant transcript and encodes isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:Bif (SH3GLB1) (NM_016009) Human Untagged Clone
Your Rating
SKU Description Size Price
RC200106 SH3GLB1 (Myc-DDK-tagged)-Human SH3-domain GRB2-like endophilin B1 (SH3GLB1), transcript variant 1 10 ug
$457.00
RC200106L1 Lenti ORF clone of Human SH3-domain GRB2-like endophilin B1 (SH3GLB1), transcript variant 1, Myc-DDK-tagged 10 ug
$757.00
RC200106L2 Lenti ORF clone of Human SH3-domain GRB2-like endophilin B1 (SH3GLB1), transcript variant 1, mGFP tagged 10 ug
$757.00
RC200106L3 Lenti ORF clone of Human SH3-domain GRB2-like endophilin B1 (SH3GLB1), transcript variant 1, Myc-DDK-tagged 10 ug
$757.00
RC200106L4 Lenti ORF clone of Human SH3-domain GRB2-like endophilin B1 (SH3GLB1), transcript variant 1, mGFP tagged 10 ug
$757.00
RG200106 SH3GLB1 (tGFP-tagged) - Human SH3-domain GRB2-like endophilin B1 (SH3GLB1), transcript variant 1 10 ug
$489.00 MSRP $657.00 MSRP $657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.