CUTA (NM_001014838) Human Untagged Clone

SKU
SC319506
CUTA (untagged)-Human cutA divalent cation tolerance homolog (E. coli) (CUTA), transcript variant 4
$150.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol CUTA
Synonyms ACHAP; C6orf82
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_001014838.1 AAATCCCAGAGGTTGGCCCCCTGAGGTGCCTCTCTGCTCCTGTCTTTTGTTTGGATGCCG
GCGCTGCTGCCTGTGGCCTCCCGCCTTTTGTTGCTACCCCGAGTCTTGCTGACCATGGCC
TCTGGAAGCCCTCCGACCCAGCCCTCGCCGGCCTCGGATTCCGGCTCTGGCTACGTTCCG
GGCTCGGTCTCTGCAGCCTTTGTTACTTGCCCCAACGAGAAGGTCGCCAAGGAGATCGCC
AGGGCCGTGGTGGAGAAGCGCCTAGCAGCCTGCGTCAACCTCATCCCTCAGATTACATCC
ATCTATGAGTGGAAAGGGAAGATCGAGGAAGACAGTGAGGTGCTGATGATGATTAAAACC
CAAAGTTCCTTGGTCCCAGCTTTGACAGATTTTGTTCGTTCTGTGCACCCTTACGAAGTG
GCCGAGGTAATTGCATTGCCTGTGGAACAGGGGAACTTTCCGTACCTGCAGTGGGTGCGC
CAGGTCACAGAGTCAGTTTCTGACTCTATCACAGTCCTGCCATGATGAGCCCTGTTCCTG
CTCATCATGAAGATCCCCGCGATACTTCAACGCCTTCTGACTTCCAGGTGATGACTGGGC
CCCCAATAAATCCCGTCTTTGGGTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire
ACCN NM_001014838
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001014838.1, NP_001014838.1
RefSeq Size 1041 bp
RefSeq ORF 471 bp
Locus ID 51596
UniProt ID O60888
Cytogenetics 6p21.32
Protein Families Transmembrane
Summary May form part of a complex of membrane proteins attached to acetylcholinesterase (AChE).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) uses an alternate splice site in the 5' coding region, compared to variant 1, resulting in a shorter protein (isoform 2). Isoform 2 has also been called isoform c. Variants 2, 3 and 4 encode the same protein.
Write Your Own Review
You're reviewing:CUTA (NM_001014838) Human Untagged Clone
Your Rating
SKU Description Size Price
RC200075 CUTA (Myc-DDK-tagged)-Human cutA divalent cation tolerance homolog (E. coli) (CUTA), transcript variant 4 10 ug
$150.00
RC200075L3 Lenti ORF clone of Human cutA divalent cation tolerance homolog (E. coli) (CUTA), transcript variant 4, Myc-DDK-tagged 10 ug
$450.00
RC200075L4 Lenti ORF clone of Human cutA divalent cation tolerance homolog (E. coli) (CUTA), transcript variant 4, mGFP tagged 10 ug
$450.00
RG200075 CUTA (tGFP-tagged) - Human cutA divalent cation tolerance homolog (E. coli) (CUTA), transcript variant 4 10 ug
$489.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.