GDF15 (NM_004864) Human Untagged Clone

CAT#: SC319494

GDF15 (untagged)-Human growth differentiation factor 15 (GDF15)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name GDF15 (NM_004864) Human Untagged Clone
Symbol GDF15
Synonyms GDF-15; MIC-1; MIC1; NAG-1; PDF; PLAB; PTGFB
Vector pCMV6-AC
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_004864.1 CCGCAACCTGCACAGCCATGCCCGGGCAAGAACTCAGGACGGTGAATGGCTCTCAGATGC
TCCTGGTGTTGCTGGTGCTCTCGTGGCTGCCGCATGGGGGCGCCCTGTCTCTGGCCGAGG
CGAGCCGCGCAAGTTTCCCGGGACCCTCAGAGTTGCACTCCGAAGACTCCAGATTCCGAG
AGTTGCGGAAACGCTACGAGGACCTGCTAACCAGGCTGCGGGCCAACCAGAGCTGGGAAG
ATTCGAACACCGACCTCGTCCCGGCCCCTGCAGTCCGGATACTCACGCCAGAAGTGCGGC
TGGGATCCGGCGGCCACCTGCACCTGCGTATCTCTCGGGCCGCCCTTCCCGAGGGGCTCC
CCGAGGCCTCCCGCCTTCACCGGGCTCTGTTCCGGCTGTCCCCGACGGCGTCAAGGTCGT
GGGACGTGACACGACCGCTGCGGCGTCAGCTCAGCCTTGCAAGACCCCAGGCGCCCGCGC
TGCACCTGCGACTGTCGCCGCCGCCGTCGCAGTCGGACCAACTGCTGGCAGAATCTTCGT
CCGCACGGCCCCAGCTGGAGTTGCACTTGCGGCCGCAAGCCGCCAGGGGGCGCCGCAGAG
CGCGTGCGCGCAACGGGGACCACTGTCCGCTCGGGCCCGGGCGTTGCTGCCGTCTGCACA
CGGTCCGCGCGTCGCTGGAAGACCTGGGCTGGGCCGATTGGGTGCTGTCGCCACGGGAGG
TGCAAGTGACCATGTGCATCGGCGCGTGCCCGAGCCAGTTCCGGGCGGCAAACATGCACG
CGCAGATCAAGACGAGCCTGCACCGCCTGAAGCCCGACACGGTGCCAGCGCCCTGCTGCG
TGCCCGCCAGCTACAATCCCATGGTGCTCATTCAAAAGACCGACACCGGGGTGTCGCTCC
AGACCTATGATGACTTGTTAGCCAAAGACTGCCACTGCATATGAGCAGTCCTGGTCCTTC
CACTGTGCACCTGCGCGGAGGACGCGACCTCAGTTGTCCTGCCCTGTGGAATGGGCTCAA
GGTTCCTGAGACACCCGATTCCTGCCCAAACAGCTGTATTTATATAAGTCTGTTATTTAT
TATTAATTTATTGGGGTGACCTTCTTGGGGACTCGGGGGCTGGTCTGATGGAACTGTGTA
TTTATTTAAAACTCTGGTGATAAAAATAAAGCTGTCTGAACTGTTAAAAAAAAAAAAAAA
AAAAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_004864.1 unedited
GACCTTTGTCATACGACTCCTATAGGGCGGCCGGGAATTCGGCACGAGGCCGCAACCTGC
ACAGCCATGTCCCGGGCAAGAACTCAGGACGGTGAATGGCTCTCAGATGCTCCTGGTGTT
GCTGGTGCTCTCGTGGCTGCCGCATGGGGGCGCCCTGTCTCTGGCCGAGGCGAGCCGCGC
AAGTTTCCCGGGACCCTCAGAGTTGCACTCCGAAGACTCCAGATTCCGAGAGTTGCGGAA
ACGCTACGAGGACCTGCTAACCAGGCTGCGGGCCAACCAGAGCTGGGAAGATTCGAACAC
CGACCTCGTCCCGGCCCCTGCAGTCCGGATACTCACGCCAGAAGTGCGGCTGGGATCCGG
CGGCCACCTGCACCTGCGTATCTCTCGGGCCGCCCTTCCCGAGGGGCTCCCCGAGGCCTC
CCGCCTTCACCGGGCTCTGTTCCGGCTGTCCCCGACGGCGTCAAGGTCGTGGGACGTGAC
ACGACCGCTGCGGCGTCAGCTCAGCCTTGCAAGACCCCAGGCGCCCGCGCTGCACCTGCG
ACTGTCGCCGCCGCCGTCGCAGTCGGACCAACTGCTGGCAGAATCTTCGTCCGCACGGCC
CCAGCTGGAGTTGCACTTGCGGCCGCAAGCCGCCAGGGGGCGCCGCAGAGCGCGTGCGCG
CAACGGGGACCACTGTCCGCTCGGGCCCGGGCGTTGCTGCCGTCTGCACACGGTCCGCGC
GTCGCTGGAAGACCTGGGCTGGGCCGATTGGTGCTGTCGCCACGGGAGGTGCAAGTGACC
ATGTGCATCGGCGGCGGTGCCCGAGCCAGTTCCGGGCGGCAAACATGCACGCGCAGATCA
GACGAGCCCTGCACCCGCTGAGCCGGACACGGTGCCAGCGCCTGGCTGGCGTGGCCCGCC
AGCTAACAATCCATGGTGGCTCATCCAAAGACCGAACCCGGGGTGTCGCTCCGAACCTAT
GAATGACCTGTAGCCAAAGAACTGG
Restriction Sites Please inquire     
Tag Tag Free
ACCN NM_004864
ORF Size 927 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_004864.1, NP_004855
RefSeq Size 1204
Locus ID 9518
Cytogenetics 19p13.11
Domains TGF-beta
Protein Families Secreted Protein, Druggable Genome
Gene Summary This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. The protein is expressed in a broad range of cell types, acts as a pleiotropic cytokine and is involved in the stress response program of cells after cellular injury. Increased protein levels are associated with disease states such as tissue hypoxia, inflammation, acute injury and oxidative stress. [provided by RefSeq, Aug 2016].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.