ID3 (NM_002167) Human Untagged Clone

CAT#: SC319486

ID3 (untagged)-Human inhibitor of DNA binding 3, dominant negative helix-loop-helix protein (ID3)


  "NM_002167" in other vectors (6)

Reconstitution Protocol

USD 150.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
ID3 mouse monoclonal antibody, clone OTI8B3 (formerly 8B3)
    • 100 ul

USD 478.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ID3
Synonyms bHLHb25; HEIR-1
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_002167.2 CGAGCGTGCGCGCGTTGCAGGTCACTGTAGCGGGACTTCTTTTGGTTTTCTTTCTCTTTG
GGGCACCTCTGGACTCACTCCCCAGCATGAAGGCGCTGAGCCCGGTGCGCGGCTGCTACG
AGGCGGTGTGCTGCCTGTCGGAACGCAGTCTGGCCATCGCCCGGGGCCGAGGGAAGGGCC
CGGCAGCTGAGGAGCCGCTGAGCTTGCTGGACGACATGAACCACTGCTACTCCCGCCTGC
GGGAACTGGTACCCGGAGTCCCGAGAGGCACTCAGCTTAGCCAGGTGGAAATCCTACAGC
GCGTCATCGACTACATTCTCGACCTGCAGGTAGTCCTGGCCGAGCCAGCCCCTGGACCCC
CTGATGGCCCCCACCTTCCCATCCAGACAGCCGAGCTCGCTCCGGAACTTGTCATCTCCA
ACGACAAAAGGAGCTTTTGCCACTGACTCGGCCGTGTCCTGACACCTCCAGAACGCAGGT
GCTGGCGCCCGTTCTGCCTGGGACCCCGGGAACCTCTCCTGCCGGAAGCCGGACGGCAGG
GATGGGCCCCAACTTCGCCCTGCCCACTTGACTTCACCAAATCCCTTCCTGGAGACTAAA
CCTGGTGCTCAGGAGCGAAGGACTGTGAACTTGTGGCCTGAAGAGCCAGAGCTAGCTCTG
GCCACCAGCTGGGCGACGTCACCCTGCTCCCACCCCACCCCCAAGTTCTAAGGTCTTTTC
AGAGCGTGGAGGTGTGGAAGGAGTGGCTGCTCTCCAAACTATGCCAAGGCGGCGGCAGAG
CTGGTCTTCTGGTCTCCTTGGAGAAAGGTTCTGTTGCCCTGATTTATGAACTCTATAATA
GAGTATATAGGTTTTGTACCTTTTTTACAGGAAGGTGACTTTCTGTAACAATGCGATGTA
TATTAAACTTTTTATAAAAGTTAACATTTTGCATAATAAACGATTTTTAAACACTTGAAA
AAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_002167
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_002167.2, NP_002158.2
RefSeq Size 1203 bp
RefSeq ORF 360 bp
Locus ID 3399
UniProt ID Q02535
Cytogenetics 1p36.12
Protein Families Druggable Genome, ES Cell Differentiation/IPS, Transcription Factors
Protein Pathways TGF-beta signaling pathway
Gene Summary The protein encoded by this gene is a helix-loop-helix (HLH) protein that can form heterodimers with other HLH proteins. However, the encoded protein lacks a basic DNA-binding domain and therefore inhibits the DNA binding of any HLH protein with which it interacts. [provided by RefSeq, Aug 2011]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.