ID3 (NM_002167) Human Untagged Clone

SKU
SC319486
ID3 (untagged)-Human inhibitor of DNA binding 3, dominant negative helix-loop-helix protein (ID3)
$150.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol ID3
Synonyms bHLHb25; HEIR-1
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_002167.2 CGAGCGTGCGCGCGTTGCAGGTCACTGTAGCGGGACTTCTTTTGGTTTTCTTTCTCTTTG
GGGCACCTCTGGACTCACTCCCCAGCATGAAGGCGCTGAGCCCGGTGCGCGGCTGCTACG
AGGCGGTGTGCTGCCTGTCGGAACGCAGTCTGGCCATCGCCCGGGGCCGAGGGAAGGGCC
CGGCAGCTGAGGAGCCGCTGAGCTTGCTGGACGACATGAACCACTGCTACTCCCGCCTGC
GGGAACTGGTACCCGGAGTCCCGAGAGGCACTCAGCTTAGCCAGGTGGAAATCCTACAGC
GCGTCATCGACTACATTCTCGACCTGCAGGTAGTCCTGGCCGAGCCAGCCCCTGGACCCC
CTGATGGCCCCCACCTTCCCATCCAGACAGCCGAGCTCGCTCCGGAACTTGTCATCTCCA
ACGACAAAAGGAGCTTTTGCCACTGACTCGGCCGTGTCCTGACACCTCCAGAACGCAGGT
GCTGGCGCCCGTTCTGCCTGGGACCCCGGGAACCTCTCCTGCCGGAAGCCGGACGGCAGG
GATGGGCCCCAACTTCGCCCTGCCCACTTGACTTCACCAAATCCCTTCCTGGAGACTAAA
CCTGGTGCTCAGGAGCGAAGGACTGTGAACTTGTGGCCTGAAGAGCCAGAGCTAGCTCTG
GCCACCAGCTGGGCGACGTCACCCTGCTCCCACCCCACCCCCAAGTTCTAAGGTCTTTTC
AGAGCGTGGAGGTGTGGAAGGAGTGGCTGCTCTCCAAACTATGCCAAGGCGGCGGCAGAG
CTGGTCTTCTGGTCTCCTTGGAGAAAGGTTCTGTTGCCCTGATTTATGAACTCTATAATA
GAGTATATAGGTTTTGTACCTTTTTTACAGGAAGGTGACTTTCTGTAACAATGCGATGTA
TATTAAACTTTTTATAAAAGTTAACATTTTGCATAATAAACGATTTTTAAACACTTGAAA
AAAAAAAAAAAAAAAA
Restriction Sites Please inquire
ACCN NM_002167
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_002167.2, NP_002158.2
RefSeq Size 1203 bp
RefSeq ORF 360 bp
Locus ID 3399
UniProt ID Q02535
Cytogenetics 1p36.12
Protein Families Druggable Genome, ES Cell Differentiation/IPS, Transcription Factors
Protein Pathways TGF-beta signaling pathway
Summary The protein encoded by this gene is a helix-loop-helix (HLH) protein that can form heterodimers with other HLH proteins. However, the encoded protein lacks a basic DNA-binding domain and therefore inhibits the DNA binding of any HLH protein with which it interacts. [provided by RefSeq, Aug 2011]
Write Your Own Review
You're reviewing:ID3 (NM_002167) Human Untagged Clone
Your Rating
SKU Description Size Price
RC200583 ID3 (Myc-DDK-tagged)-Human inhibitor of DNA binding 3, dominant negative helix-loop-helix protein (ID3) 10 ug
$225.00
RC200583L1 Lenti ORF clone of Human inhibitor of DNA binding 3, dominant negative helix-loop-helix protein (ID3), Myc-DDK-tagged 10 ug
$525.00
RC200583L2 Lenti ORF clone of Human inhibitor of DNA binding 3, dominant negative helix-loop-helix protein (ID3), mGFP tagged 10 ug
$525.00
RC200583L3 Lenti ORF clone of Human inhibitor of DNA binding 3, dominant negative helix-loop-helix protein (ID3), Myc-DDK-tagged 10 ug
$525.00
RC200583L4 Lenti ORF clone of Human inhibitor of DNA binding 3, dominant negative helix-loop-helix protein (ID3), mGFP tagged 10 ug
$525.00
RG200583 ID3 (tGFP-tagged) - Human inhibitor of DNA binding 3, dominant negative helix-loop-helix protein (ID3) 10 ug
$425.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.