ID3 (NM_002167) Human Untagged Clone
SKU
SC319486
ID3 (untagged)-Human inhibitor of DNA binding 3, dominant negative helix-loop-helix protein (ID3)
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | ID3 |
Synonyms | bHLHb25; HEIR-1 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>OriGene sequence for NM_002167.2
CGAGCGTGCGCGCGTTGCAGGTCACTGTAGCGGGACTTCTTTTGGTTTTCTTTCTCTTTG
GGGCACCTCTGGACTCACTCCCCAGCATGAAGGCGCTGAGCCCGGTGCGCGGCTGCTACG AGGCGGTGTGCTGCCTGTCGGAACGCAGTCTGGCCATCGCCCGGGGCCGAGGGAAGGGCC CGGCAGCTGAGGAGCCGCTGAGCTTGCTGGACGACATGAACCACTGCTACTCCCGCCTGC GGGAACTGGTACCCGGAGTCCCGAGAGGCACTCAGCTTAGCCAGGTGGAAATCCTACAGC GCGTCATCGACTACATTCTCGACCTGCAGGTAGTCCTGGCCGAGCCAGCCCCTGGACCCC CTGATGGCCCCCACCTTCCCATCCAGACAGCCGAGCTCGCTCCGGAACTTGTCATCTCCA ACGACAAAAGGAGCTTTTGCCACTGACTCGGCCGTGTCCTGACACCTCCAGAACGCAGGT GCTGGCGCCCGTTCTGCCTGGGACCCCGGGAACCTCTCCTGCCGGAAGCCGGACGGCAGG GATGGGCCCCAACTTCGCCCTGCCCACTTGACTTCACCAAATCCCTTCCTGGAGACTAAA CCTGGTGCTCAGGAGCGAAGGACTGTGAACTTGTGGCCTGAAGAGCCAGAGCTAGCTCTG GCCACCAGCTGGGCGACGTCACCCTGCTCCCACCCCACCCCCAAGTTCTAAGGTCTTTTC AGAGCGTGGAGGTGTGGAAGGAGTGGCTGCTCTCCAAACTATGCCAAGGCGGCGGCAGAG CTGGTCTTCTGGTCTCCTTGGAGAAAGGTTCTGTTGCCCTGATTTATGAACTCTATAATA GAGTATATAGGTTTTGTACCTTTTTTACAGGAAGGTGACTTTCTGTAACAATGCGATGTA TATTAAACTTTTTATAAAAGTTAACATTTTGCATAATAAACGATTTTTAAACACTTGAAA AAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_002167 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_002167.2, NP_002158.2 |
RefSeq Size | 1203 bp |
RefSeq ORF | 360 bp |
Locus ID | 3399 |
UniProt ID | Q02535 |
Cytogenetics | 1p36.12 |
Protein Families | Druggable Genome, ES Cell Differentiation/IPS, Transcription Factors |
Protein Pathways | TGF-beta signaling pathway |
Summary | The protein encoded by this gene is a helix-loop-helix (HLH) protein that can form heterodimers with other HLH proteins. However, the encoded protein lacks a basic DNA-binding domain and therefore inhibits the DNA binding of any HLH protein with which it interacts. [provided by RefSeq, Aug 2011] |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC200583 | ID3 (Myc-DDK-tagged)-Human inhibitor of DNA binding 3, dominant negative helix-loop-helix protein (ID3) | 10 ug |
$225.00
|
|
RC200583L1 | Lenti ORF clone of Human inhibitor of DNA binding 3, dominant negative helix-loop-helix protein (ID3), Myc-DDK-tagged | 10 ug |
$525.00
|
|
RC200583L2 | Lenti ORF clone of Human inhibitor of DNA binding 3, dominant negative helix-loop-helix protein (ID3), mGFP tagged | 10 ug |
$525.00
|
|
RC200583L3 | Lenti ORF clone of Human inhibitor of DNA binding 3, dominant negative helix-loop-helix protein (ID3), Myc-DDK-tagged | 10 ug |
$525.00
|
|
RC200583L4 | Lenti ORF clone of Human inhibitor of DNA binding 3, dominant negative helix-loop-helix protein (ID3), mGFP tagged | 10 ug |
$525.00
|
|
RG200583 | ID3 (tGFP-tagged) - Human inhibitor of DNA binding 3, dominant negative helix-loop-helix protein (ID3) | 10 ug |
$425.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.