CLPP (NM_006012) Human Untagged Clone

SKU
SC319485
CLPP (untagged)-Human ClpP caseinolytic peptidase, ATP-dependent, proteolytic subunit homolog (E. coli) (CLPP), nuclear gene encoding mitochondrial protein
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol CLPP
Synonyms DFNB81; PRLTS3
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_006012.2 CCTTAATGGCGCCCGCCCAGACTCCTGGAAGTGAGCGGCCTAGCGAGCGAGCTCCCAGGC
GCAAAGCACGCCGGAAGCTGTAGTTCCGCCATCGGACGGAAGCCGACCGGGGCGTGCGGA
GGGATGTGGCCCGGAATATTGGTAGGGGGGGCCCGGGTGGCGTCATGCAGGTACCCCGCG
CTGGGGCCTCGCCTCGCCGCTCACTTTCCAGCGCAGCGGCCGCCGCAGCGGACACTCCAG
AACGGCCTGGCCCTGCAGCGGTGCCTGCACGCGACGGCGACCCGGGCTCTCCCGCTCATT
CCCATCGTGGTGGAGCAGACGGGTCGCGGCGAGCGCGCCTATGACATCTACTCGCGGCTG
CTGCGGGAGCGCATCGTGTGCGTCATGGGCCCGATCGATGACAGCGTTGCCAGCCTTGTT
ATCGCACAGCTCCTCTTCCTGCAATCCGAGAGCAACAAGAAGCCCATCCACATGTACATC
AACAGCCCTGGTGGTGTGGTGACCGCGGGCCTGGCCATCTACGACACGATGCAGTACATC
CTCAACCCGATCTGCACCTGGTGCGTGGGCCAGGCCGCCAGCATGGGCTCCCTGCTTCTC
GCCGCCGGCACCCCAGGCATGCGCCACTCGCTCCCCAACTCCCGTATCATGATCCACCAG
CCCTCAGGAGGCGCCCGGGGCCAAGCCACAGACATTGCCATCCAGGCAGAGGAGATCATG
AAGCTCAAGAAGCAGCTCTATAACATCTACGCCAAGCACACCAAACAGAGCCTGCAGGTG
ATCGAGTCCGCCATGGAGAGGGACCGCTACATGAGCCCCATGGAGGCCCAGGAGTTTGGC
ATCTTAGACAAGGTTCTGGTCCACCCTCCCCAGGACGGTGAGGATGAGCCCACGCTGGTG
CAGAAGGAGCCTGTAGAAGCAGCGCCGGCAGCAGAACCTGTCCCAGCTAGCACCTGAGAG
CTGGGCCTCCTCTCCAGAATCATGTGGAGGGGCCAGAGGCCTGCCAGACCCCCAGCTGGG
CCCTGCTCACCCCTTGTTGCTGGGCTTGGAGGGGCCTCTTGAGGAACTTTTAATTTGCAG
GGGTGCCCGCTATGGACGGGGCATTCCAGCTGAGACACTGTGATTTTAAATTAAATCTTT
GTGGTCTTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire
ACCN NM_006012
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_006012.2, NP_006003.1
RefSeq Size 1194 bp
RefSeq ORF 834 bp
Locus ID 8192
UniProt ID Q16740
Cytogenetics 19p13.3
Domains CLP_protease
Protein Families Druggable Genome, Protease
Summary The protein encoded by this gene belongs to the peptidase family S14 and hydrolyzes proteins into small peptides in the presence of ATP and magnesium. The protein is transported into mitochondrial matrix and is associated with the inner mitochondrial membrane. [provided by RefSeq, Jul 2008]
Write Your Own Review
You're reviewing:CLPP (NM_006012) Human Untagged Clone
Your Rating
SKU Description Size Price
RC200301 CLPP (Myc-DDK-tagged)-Human ClpP caseinolytic peptidase, ATP-dependent, proteolytic subunit homolog (E. coli) (CLPP), nuclear gene encoding mitochondrial protein 10 ug
$450.00
RC200301L1 Lenti ORF clone of Human ClpP caseinolytic peptidase, ATP-dependent, proteolytic subunit homolog (E. coli) (CLPP), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged 10 ug
$750.00
RC200301L2 Lenti ORF clone of Human ClpP caseinolytic peptidase, ATP-dependent, proteolytic subunit homolog (E. coli) (CLPP), nuclear gene encoding mitochondrial protein, mGFP tagged 10 ug
$750.00
RC200301L3 Lenti ORF clone of Human ClpP caseinolytic peptidase, ATP-dependent, proteolytic subunit homolog (E. coli) (CLPP), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged 10 ug
$750.00
RC200301L4 Lenti ORF clone of Human ClpP caseinolytic peptidase, ATP-dependent, proteolytic subunit homolog (E. coli) (CLPP), nuclear gene encoding mitochondrial protein, mGFP tagged 10 ug
$750.00
RG200301 CLPP (tGFP-tagged) - Human ClpP caseinolytic peptidase, ATP-dependent, proteolytic subunit homolog (E. coli) (CLPP), nuclear gene encoding mitochondrial protein 10 ug
$650.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.