NDUFV2 (NM_021074) Human Untagged Clone
SKU
SC319467
NDUFV2 (untagged)-Human NADH dehydrogenase (ubiquinone) flavoprotein 2, 24kDa (NDUFV2), nuclear gene encoding mitochondrial protein
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | NDUFV2 |
Synonyms | CI-24k; MC1DN7 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>OriGene sequence for NM_021074.1
GGAAGGTGAACAGTGTGGCCCGCCATGTTCTTCTCCGCGGCGCTCCGGGCCCGGGCGGCT
GGCCTCACCGCCCACTGGGGAAGACATGTAAGGAATTTGCATAAGACAGTTATGCAAAAT GGAGCTGGAGGAGCTTTATTTGTGCACAGAGATACTCCTGAGAATAACCCTGATACTCCA TTTGATTTCACACCAGAAAACTATAAGAGGATAGAGGCAATTGTAAAAAACTATCCAGAA GGCCATAAAGCAGCAGCTGTTCTTCCAGTCCTGGATTTAGCCCAAAGGCAGAATGGGTGG TTGCCCATCTCTGCTATGAACAAGGTTGCAGAAGTTTTACAAGTACCTCCAATGAGAGTA TATGAAGTAGCAACTTTTTATACAATGTATAATCGAAAGCCAGTTGGAAAGTATCACATT CAGGTCTGCACTACTACACCCTGCATGCTTCGAAACTCTGACAGCATACTGGAGGCCATT CAGAAAAAGCTTGGAATAAAGGTTGGGGAGACTACACCTGACAAACTTTTCACTCTTATA GAAGTGGAATGTTTAGGGGCCTGTGTGAACGCACCAATGGTTCAAATAAATGACAATTAC TATGAGGATTTGACAGCTAAGGATATTGAAGAAATTATTGATGAGCTCAAGGCTGGCAAA ATCCCAAAACCAGGGCCAAGGAGTGGACGCTTCTCTTGTGAGCCAGCTGGAGGTCTTACC TCTTTGACTGAACCACCCAAGGGACCTGGATTTGGTGTACAAGCAGGCCTTTAATTTATA TTGAACTGTAAATATGTCACTAGAGAAATAAAATATGGACTTCCAATCTACGTAAAAAAA AAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_021074 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_021074.1, NP_066552.1 |
RefSeq Size | 827 bp |
RefSeq ORF | 750 bp |
Locus ID | 4729 |
UniProt ID | P19404 |
Cytogenetics | 18p11.22 |
Domains | complex1_24kD |
Protein Families | Druggable Genome |
Protein Pathways | Alzheimer's disease, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease |
Summary | The NADH-ubiquinone oxidoreductase complex (complex I) of the mitochondrial respiratory chain catalyzes the transfer of electrons from NADH to ubiquinone, and consists of at least 43 subunits. The complex is located in the inner mitochondrial membrane. This gene encodes the 24 kDa subunit of complex I, and is involved in electron transfer. Mutations in this gene are implicated in Parkinson's disease, bipolar disorder, schizophrenia, and have been found in one case of early onset hypertrophic cardiomyopathy and encephalopathy. A non-transcribed pseudogene of this locus is found on chromosome 19. [provided by RefSeq, Oct 2009] |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC200653 | NDUFV2 (Myc-DDK-tagged)-Human NADH dehydrogenase (ubiquinone) flavoprotein 2, 24kDa (NDUFV2), nuclear gene encoding mitochondrial protein | 10 ug |
$300.00
|
|
RC200653L3 | Lenti ORF clone of Human NADH dehydrogenase (ubiquinone) flavoprotein 2, 24kDa (NDUFV2), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged | 10 ug |
$600.00
|
|
RC200653L4 | Lenti ORF clone of Human NADH dehydrogenase (ubiquinone) flavoprotein 2, 24kDa (NDUFV2), nuclear gene encoding mitochondrial protein, mGFP tagged | 10 ug |
$600.00
|
|
RG200653 | NDUFV2 (tGFP-tagged) - Human NADH dehydrogenase (ubiquinone) flavoprotein 2, 24kDa (NDUFV2), nuclear gene encoding mitochondrial protein | 10 ug |
$489.00
MSRP
$500.00
MSRP
$500.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.