PEX16 (NM_004813) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | PEX16 |
Synonyms | PBD8A; PBD8B |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>OriGene sequence for NM_004813.1
CGAGGGCAGGATGGAGAAGCTGCGGCTCCTGGGCCTCCGCTACCAGGAGTACGTGACTCG
TCACCCGGCCGCCACGGCCCAGCTGGAGACAGCAGTGCGGGGCTTCAGTTACCTGCTGGC AGGTCGATTCGCCGATTCGCACGAGCTGTCAGAGCTGGTGTACTCTGCCTCTAACCTGCT TGTGCTGCTCAATGACGGGATCCTACGGAAGGAGCTTCGGAAAAAGTTGCCTGTGTCGCT GTCCCAGCAGAAGCTGCTGACATGGCTGAGCGTGCTGGAGTGCGTGGAGGTGTTCATGGA GATGGGAGCTGCCAAGGTGTGGGGTGAAGTGGGCCGCTGGCTTGTCATCGCCCTCATCCA GCTGGCCAAGGCTGTACTGCGGATGCTCCTGCTGCTCTGGTTCAAGGCTGGCCTCCAGAC TTCACCCCCTATCGTTCCACTGGACAGAGAGACCCAGGCACAGCCCCCGGATGGTGACCA CAGCCCTGGCAACCATGAGCAGTCCTACGTGGGGAAGCGGTCAAACCGGGTGGTGCGAAC CCTCCAGAACACGCCGTCCCTGCACTCCAGGCACTGGGGAGCTCCCCAGCAGCGGGAGGG ACGGCAGCAGCAGCATCACGAGGAGCTGAGTGCGACCCCCACCCCCCTGGGGCTGCAGGA GACCATCGCAGAGTTTTTGTACATTGCCCGGCCGCTGCTGCACTTGCTCAGCCTGGGCCT GTGGGGTCAGAGGTCGTGGAAACCCTGGCTCTTGGCTGGTGTTGTGGACGTGACCAGCCT GAGCCTCCTGAGTGACAGAAAGGGCCTGACCCGGAGGGAGCGGCGGGAGCTGCGGCGCCG GACCATCCTGCTGCTCTACTACCTGCTGCGCTCTCCTTTCTACGACCGCTTCTCCGAGGC CAGGATCCTCTTCCTGCTCCAGTTGCTGGCCGACCACGTCCCTGGCGTTGGCCTGGTCAC AAGGCCGCTCATGGATTACTTGCCCACCTGGCAGAAAATCTACTTCTACAGTTGGGGCTG ACAGACCTCCCGGAAGGAGGGTGTGGGGAGGGGTGGGGCAGGGAGCCCCTCTTCCCTAAT AAAACTGACTCCGGCAGCGAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_004813 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_004813.1, NP_004804.1 |
RefSeq Size | 1361 bp |
RefSeq ORF | 1011 bp |
Locus ID | 9409 |
UniProt ID | Q9Y5Y5 |
Cytogenetics | 11p11.2 |
Summary | The protein encoded by this gene is an integral peroxisomal membrane protein. An inactivating nonsense mutation localized to this gene was observed in a patient with Zellweger syndrome of the complementation group CGD/CG9. Expression of this gene product morphologically and biochemically restores the formation of new peroxisomes, suggesting a role in peroxisome organization and biogenesis. Alternative splicing has been observed for this gene and two variants have been described. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) uses an alternate terminal exon. The encoded isoform (1) is shorter than isoform 2 and has a unique C-terminus. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC201115 | PEX16 (Myc-DDK-tagged)-Human peroxisomal biogenesis factor 16 (PEX16), transcript variant 1 | 10 ug |
$686.00
|
|
RC201115L3 | Lenti ORF clone of Human peroxisomal biogenesis factor 16 (PEX16), transcript variant 1, Myc-DDK-tagged | 10 ug |
$986.00
|
|
RC201115L4 | Lenti ORF clone of Human peroxisomal biogenesis factor 16 (PEX16), transcript variant 1, mGFP tagged | 10 ug |
$986.00
|
|
RG201115 | PEX16 (tGFP-tagged) - Human peroxisomal biogenesis factor 16 (PEX16), transcript variant 1 | 10 ug |
$886.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.