SCNM1 (NM_024041) Human Untagged Clone

SKU
SC319397
SCNM1 (untagged)-Human sodium channel modifier 1 (SCNM1), transcript variant 1
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol SCNM1
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_024041.2 GCTCTTGCTACGGTGGCCTGGAGGAGTGGCGAAACCGGAACAGAGAATTTATCACTTCTG
GGACTCACAGTCGTGATGTCTTTCAAGAGGGAAGGAGACGATTGGAGTCAACTCAATGTG
CTCAAAAAAAGAAGAGTCGGGGACCTCCTAGCCAGTTACATTCCAGAGGATGAGGCGCTG
ATGCTTCGGGATGGACGCTTTGCTTGTGCCATCTGCCCCCATCGACCGGTACTGGACACC
CTGGCCATGCTGACTGCCCACCGTGCAGGCAAGAAACATCTGTCCAGCTTGCAGCTTTTC
TATGGCAAGAAGCAGCCGGGAAAGGAAAGAAAGCAGAATCCAAAACATCAGAATGAATTG
AGAAGGGAAGAAACCAAAGCTGAGGCTCCTCTGCTAACTCAGACACGACTTATCACCCAG
AGTGCTCTGCACAGAGCTCCCCACTATAACAGTTGCTGCCGCCGGAAGTACAGACCAGAA
GCCCCTGGTCCCTCTGTCTCCCTTTCCCCTATGCCACCCTCAGAGGTCAAACTCCAAAGT
GGGAAGATCAGTAGGGAACCTGAACCTGCGGCTGGCCCACAGGCCGAGGAGTCAGCAACT
GTCTCAGCCCCTGCACCCATGAGCCCCACAAGAAGACGAGCCCTGGACCATTATCTCACC
CTTCGAAGCTCTGGATGGATCCCAGATGGACGAGGTCGATGGGTAAAAGATGAAAATGTT
GAGTTTGACTCTGATGAGGAGGAACCACCTGATCTCCCCTTGGACTGATACCCTTTTCCC
ATTCATTCACAAATAAATTACAATGGGTGCTGAGAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAA
Restriction Sites Please inquire
ACCN NM_024041
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_024041.2, NP_076946.1
RefSeq Size 858 bp
RefSeq ORF 693 bp
Locus ID 79005
UniProt ID Q9BWG6
Cytogenetics 1q21.3
Summary SCNM1 is a zinc finger protein and putative splicing factor. In mice, Scnm1 modifies phenotypic expression of Scn8a (MIM 600702) mutations (Buchner et al., 2003 [PubMed 12920299]).[supplied by OMIM, Oct 2009]
Transcript Variant: This variant (1) encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:SCNM1 (NM_024041) Human Untagged Clone
Your Rating
SKU Description Size Price
RC200987 SCNM1 (Myc-DDK-tagged)-Human sodium channel modifier 1 (SCNM1), transcript variant 1 10 ug
$300.00
RC200987L1 Lenti ORF clone of Human sodium channel modifier 1 (SCNM1), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC200987L2 Lenti ORF clone of Human sodium channel modifier 1 (SCNM1), transcript variant 1, mGFP tagged 10 ug
$600.00
RC200987L3 Lenti ORF clone of Human sodium channel modifier 1 (SCNM1), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC200987L4 Lenti ORF clone of Human sodium channel modifier 1 (SCNM1), transcript variant 1, mGFP tagged 10 ug
$600.00
RG200987 SCNM1 (tGFP-tagged) - Human sodium channel modifier 1 (SCNM1), transcript variant 1 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.