COPS6 (NM_006833) Human Untagged Clone

SKU
SC319375
COPS6 (untagged)-Human COP9 constitutive photomorphogenic homolog subunit 6 (Arabidopsis) (COPS6)
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol COPS6
Synonyms CSN6; MOV34-34KD
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_006833.4 GGAAAATGGCGGCGGCGGCGGCGGCGGCTGCAGCTACGAACGGGACCGGAGGAAGCAGCG
GGATGGAGGTGGATGCAGCAGTAGTCCCCAGCGTGATGGCCTGCGGAGTGACTGGGAGTG
TTTCCGTCGCTCTCCATCCCCTTGTCATTCTCAACATCTCAGACCACTGGATCCGCATGC
GCTCCCAGGAGGGGCGGCCTGTGCAGGTGATTGGGGCTCTGATTGGCAAGCAGGAGGGCC
GAAATATCGAGGTGATGAACTCCTTTGAGCTGCTGTCCCACACCGTGGAAGAGAAGATTA
TCATTGACAAGGAATATTATTACACCAAGGAGGAGCAGTTTAAACAGGTGTTCAAGGAGC
TGGAGTTTCTGGGTTGGTATACCACAGGGGGGCCACCTGACCCCTCGGACATCCACGTCC
ATAAGCAGGTGTGTGAGATCATCGAGAGCCCCCTCTTTCTGAAGTTGAACCCTATGACCA
AGCACACAGATCTTCCTGTCAGCGTTTTTGAGTCTGTCATTGATATAATCAATGGAGAGG
CCACAATGCTGTTTGCTGAGCTGACCTACACTCTGGCCACAGAGGAAGCGGAACGCATTG
GTGTAGACCACGTAGCCCGAATGACAGCAACAGGCAGTGGAGAGAACTCCACTGTGGCTG
AACACCTGATAGCACAGCACAGCGCCATCAAGATGCTGCACAGCCGCGTCAAGCTCATCT
TGGAGTACGTCAAGGCCTCTGAAGCGGGAGAGGTCCCCTTTAATCATGAGATCCTGCGGG
AGGCCTATGCTCTGTGTCACTGTCTCCCGGTGCTCAGCACAGACAAGTTCAAGACAGATT
TTTATGATCAATGCAACGACGTGGGGCTCATGGCCTACCTCGGCACCATCACCAAAACGT
GCAACACCATGAACCAGTTTGTGAACAAGTTCAATGTCCTCTACGACCGACAAGGCATCG
GCAGGAGAATGCGCGGGCTCTTTTTCTGATGAGGGTACTTGAAGGGCTGATGGACAGGGG
TCAGGCAACTATCCCAAAGGGGAGGGCACTACACTTCCTTGAGAGAAACCGCTGTCATTA
ATAAAAGGGGAGCAGCCCCTGAGCACCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire
ACCN NM_006833
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_006833.4, NP_006824.2
RefSeq Size 1441 bp
RefSeq ORF 984 bp
Locus ID 10980
UniProt ID Q7L5N1
Cytogenetics 7q22.1
Domains JAB_MPN
Protein Families Druggable Genome, Stem cell - Pluripotency
Summary The protein encoded by this gene is one of the eight subunits of COP9 signalosome, a highly conserved protein complex that functions as an important regulator in multiple signaling pathways. The structure and function of COP9 signalosome is similar to that of the 19S regulatory particle of 26S proteasome. COP9 signalosome has been shown to interact with SCF-type E3 ubiquitin ligases and act as a positive regulator of E3 ubiquitin ligases. This protein belongs to translation initiation factor 3 (eIF3) superfamily. It is involved in the regulation of cell cycle and likely to be a cellular cofactor for HIV-1 accessory gene product Vpr. [provided by RefSeq, Jul 2008]
Write Your Own Review
You're reviewing:COPS6 (NM_006833) Human Untagged Clone
Your Rating
SKU Description Size Price
RC200252 COPS6 (Myc-DDK-tagged)-Human COP9 constitutive photomorphogenic homolog subunit 6 (Arabidopsis) (COPS6) 10 ug
$300.00
RC200252L3 Lenti ORF clone of Human COP9 constitutive photomorphogenic homolog subunit 6 (Arabidopsis) (COPS6), Myc-DDK-tagged 10 ug
$600.00
RC200252L4 Lenti ORF clone of Human COP9 constitutive photomorphogenic homolog subunit 6 (Arabidopsis) (COPS6), mGFP tagged 10 ug
$600.00
RG200252 COPS6 (tGFP-tagged) - Human COP9 constitutive photomorphogenic homolog subunit 6 (Arabidopsis) (COPS6) 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.