GRB2 (NM_002086) Human Untagged Clone

CAT#: SC319370

GRB2 (untagged)-Human growth factor receptor-bound protein 2 (GRB2), transcript variant 1

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name GRB2 (NM_002086) Human Untagged Clone
Symbol GRB2
Synonyms ASH; EGFRBP-GRB2; Grb3-3; MST084; MSTP084; NCKAP2
Vector pCMV6-AC
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_002086.3 GACCGGGCGGCGGCAGCGGCGGCGGCGGCTGTGGCAGAGTCTGTGCCTGTGGCGGTGACG
GCGGCGGGAGCAAGCGCTGCCCTCGCAGAGCAGCCTTGGGGTCGCCGGCCGCTCGCAGCG
TTGTGGAGGGGCGGGCCGGACGCTGAGCGGAGCAGCTGCGCCACGGGTGGCATTGTGTGT
CCCAGAGTGCCGGAGCGAGTCCCAGAAGAGAGGCGAGGCTAAGCCCAGAGCGCTGGGTTG
CTTCAGCAGGGAAGACTCCCTTCCCCCTGCTTCAGGCTGCTGAGCACTGAGCAGCGCTCA
GAATGGAAGCCATCGCCAAATATGACTTCAAAGCTACTGCAGACGACGAGCTGAGCTTCA
AAAGGGGGGACATCCTCAAGGTTTTGAACGAAGAATGTGATCAGAACTGGTACAAGGCAG
AGCTTAATGGAAAAGACGGCTTCATTCCCAAGAACTACATAGAAATGAAACCACATCCGT
GGTTTTTTGGCAAAATCCCCAGAGCCAAGGCAGAAGAAATGCTTAGCAAACAGCGGCACG
ATGGGGCCTTTCTTATCCGAGAGAGTGAGAGCGCTCCTGGGGACTTCTCCCTCTCTGTCA
AGTTTGGAAACGATGTGCAGCACTTCAAGGTGCTCCGAGATGGAGCCGGGAAGTACTTCC
TCTGGGTGGTGAAGTTCAATTCTTTGAATGAGCTGGTGGATTATCACAGATCTACATCTG
TCTCCAGAAACCAGCAGATATTCCTGCGGGACATAGAACAGGTGCCACAGCAGCCGACAT
ACGTCCAGGCCCTCTTTGACTTTGATCCCCAGGAGGATGGAGAGCTGGGCTTCCGCCGGG
GAGATTTTATCCATGTCATGGATAACTCAGACCCCAACTGGTGGAAAGGAGCTTGCCACG
GGCAGACCGGCATGTTTCCCCGCAATTATGTCACCCCCGTGAACCGGAACGTCTAAGAGT
CAAGAAGCAATTATTTAAAGAAAGTGAAAAATGTAAAACACATACAAAAGAATTAAACCC
ACAAGCTGCCTCTGACAGCAGCCTGTGAGGGAGTGCAGAACACCTGGCCGGGTCACCCTG
TGACCCTCTCACTTTGGTTGGAACTTTAGGGGGTGGGAGGGGGCGTTGGATTTAAAAATG
CCAAAACTTACCTATAAATTAAGAAGAGTTTTTATTACAAATTTTCACTGCTGCTCCTCT
TTCCCCTCCTTTGTCTTTTTTTTCATCCTTTTTTCTCTTCTGTCCATCAGTGCATGACGT
TTAAGGCCACGTATAGTCCTAGCTGACGCCAATAATAAAAAACAAGAAACCAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_002086.3 unedited
GACTATTGTCATACGACTCCTATAGGGCGGCCGGGAATTCGGCACGAGGGACCGGGCGGC
GGCAGCGGCGGCGGCGGCTGTGGCAGAGTCTGTGCCTGTGGCGGTGACGGCGGCGGGAGC
AAGCGCTGCCCTCGCAGAGCAGCCTTGGGGTCGCCGGCCGCTCGCAGCGTTGTGGAGGGG
CGGGCCGGACGCTGAGCGGAGCAGCTGCGCCACGGGTGGCATTGTGTGTCCCAGAGTGCC
GGAGCGAGTCCCAGAAGAGAGGCGAGGCTAAGCCCAGAGCGCTGGGTTGCTTCAGCAGGG
AAGACTCCCTTCCCCCTGCTTCAGGCTGCTGAGCACTGAGCAGCGCTCAGAATGGAAGCC
ATCGCCAAATATGACTTCAAAGCTACTGCAGACGACGAGCTGAGCTTCAAAAGGGGGGAC
ATCCTCAAGGTTTTGAACGAAGAATGTGATCAGAACTGGTACAAGGCAGAGCTTAATGGA
AAAGACGGCTTCATTCCCAAGAACTACATAGAAATGAAACCACATCCGTGGTTTTTTGGC
AAAATCCCCAGAGCCAAGGCAGAAGAATGCTTAGCAAACAGCGGCACGATGGGGCCTTTC
TTATCCGAGAGAGTGAGAGCGCTCCTGGGGACTTCTCCCTCTCTGTCAAGTTTGGAAACG
ATGTGCAGCACTTCAAGGTGCTCCGAGATGGAGCCGGGAAGTACTTTCCTCTGGGTGGTG
AAGTTCAATTTCTTTGAATGAGCTGGTGGATTATCACAGATCTACATCTGTCTCAGAAAC
CAGCAGATATTCCTGGCGGGACATAGACAGGTGCCACAGCAGCCCGAACATAACGTCCAG
GCCCTCTTTGACTTTGATCCCAGAGATGGAAGCTGGGCTCCGCCGGGGGAAGAATTTTAT
CATGTCATTGAATAACTCAAGACCTCACTGGTGGCAACGGACCTGCCACGGGCCAGAACC
GGCCATGG
Restriction Sites Please inquire     
Tag Tag Free
ACCN NM_002086
ORF Size 654 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_002086.3, NP_002077
RefSeq Size 3317
Locus ID 2885
Cytogenetics 17q25.1
Domains SH2, SH3
Protein Families Druggable Genome
Protein Pathways MAPK signaling pathway, ErbB signaling pathway, Chemokine signaling pathway, Dorso-ventral axis formation, Focal adhesion, Gap junction, Jak-STAT signaling pathway, Natural killer cell mediated cytotoxicity, T cell receptor signaling pathway, B cell receptor signaling pathway, Fc epsilon RI signaling pathway, Neurotrophin signaling pathway, Insulin signaling pathway, GnRH signaling pathway, Pathways in cancer, Colorectal cancer, Renal cell carcinoma, Endometrial cancer, Glioma, Prostate cancer, Chronic myeloid leukemia, Acute myeloid leukemia, Non-small cell lung cancer
Gene Summary Isoform 2 does not bind to phosphorylated epidermal growth factor receptor (EGFR) but inhibits EGF-induced transactivation of a RAS-responsive element. Isoform 2 acts as a dominant negative protein over GRB2 and by suppressing proliferative signals, may trigger active programmed cell death. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations