DDAH2 (NM_013974) Human Untagged Clone

SKU
SC319363
DDAH2 (untagged)-Human dimethylarginine dimethylaminohydrolase 2 (DDAH2)
$450.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol DDAH2
Synonyms DDAH; DDAHII; G6a; HEL-S-277; NG30
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_013974.1 CTAAAAGCCAGAGCTCCCAGTCCCCGAGGCTTGAAGACGGGGACTCCCTTCTCCACCAAC
TCTGTCCTCGGGGGGTGGGGCCCCAGCCGAGATCACAGCGCGACAGGAGTGGGGGTGGCC
GCTGGAGACAGGTGAAGAAACAAGAAAACTAAGAAATCCGAGCGGTTGGAGGGGGAGTCT
GTGTGGATGGGATGGGGACGCCGGGGGAGGGGCTGGGCCGCTGCTCCCATGCCCTGATCC
GGGGAGTCCCAGAGAGCCTGGCGTCGGGGGAAGGTGCGGGGGCTGGCCTTCCCGCTCTGG
ATCTGGCCAAAGCTCAAAGGGAGCACGGGGTGCTGGGAGGTAAACTGAGGCAACGACTGG
GGCTACAGCTGCTAGAACTGCCACCTGAGGAGTCATTGCCGCTGGGACCGCTGCTTGGCG
ACACGGCCGTGATCCAAGGGGACACGGCCCTAATCACGCGGCCCTGGAGCCCCGCTCGTA
GGCCAGAGGTCGATGGAGTCCGCAAAGCCCTGCAAGACCTGGGGCTCCGAATTGTGGAAA
TAGGAGACGAGAACGCGACGCTGGATGGCACTGACGTTCTCTTCACCGGCCGGGAGTTTT
TCGTAGGCCTCTCCAAATGGACCAATCACCGAGGAGCTGAGATCGTGGCGGACACGTTCC
GGGACTTCGCCGTCTCCACTGTGCCAGTCTCGGGTCCCTCCCACCTGCGCGGTCTCTGCG
GCATGGGGGGACCTCGCACTGTTGTGGCAGGCAGCAGCGACGCTGCCCAAAAGGCTGTCC
GGGCAATGGCAGTGCTGACAGATCACCCATATGCCTCCCTGACCCTCCCAGATGACGCAG
CTGCTGACTGTCTCTTTCTTCGTCCTGGGTTGCCTGGTGTGCCCCCTTTCCTCCTGCACC
GTGGAGGTGGGGATCTGCCCAACAGCCAGGAGGCACTGCAGAAGCTCTCTGATGTCACCC
TGGTACCTGTGTCCTGCTCAGAACTGGAGAAGGCTGGCGCCGGGCTCAGCTCCCTCTGCT
TGGTGCTCAGCACACGCCCCCACAGCTGAGGGCCTGGCCTTGGGGTACTGCTGGCCAGGG
GTAGGATAGTATAGGAAGTAGAAGGGGAAGGAGGGTTAGATAGAGAATGCTGAATAGGCA
GTAGTTGGGAGAGAGCCTCAATATTGGGGGAGGGGAGAGTGTAGGGAAAAGGATCCACTG
GGTGAATCCTCCCTCTCAGAACCAATAAAATAGAATTGACCTTTTAAAAAAAAAAAAAAA
AAA
Restriction Sites Please inquire
ACCN NM_013974
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_013974.1, NP_039268.1
RefSeq Size 1351 bp
RefSeq ORF 858 bp
Locus ID 23564
UniProt ID O95865
Cytogenetics 6p21.33
Domains Amidinotransf
Summary This gene encodes a dimethylarginine dimethylaminohydrolase. The encoded enzyme functions in nitric oxide generation by regulating the cellular concentrations of methylarginines, which in turn inhibit nitric oxide synthase activity. The protein may be localized to the mitochondria. Alternative splicing resulting in multiple transcript variants. [provided by RefSeq, Dec 2014]
Transcript Variant: This variant (2) lacks a segment of the 5' UTR, compared to variant 1. Variants 1, 2, and 3 encode the same protein.
Write Your Own Review
You're reviewing:DDAH2 (NM_013974) Human Untagged Clone
Your Rating
SKU Description Size Price
RC200287 DDAH2 (Myc-DDK-tagged)-Human dimethylarginine dimethylaminohydrolase 2 (DDAH2) 10 ug
$450.00
RC200287L1 Lenti ORF clone of Human dimethylarginine dimethylaminohydrolase 2 (DDAH2), Myc-DDK-tagged 10 ug
$750.00
RC200287L2 Lenti ORF clone of Human dimethylarginine dimethylaminohydrolase 2 (DDAH2), mGFP tagged 10 ug
$750.00
RC200287L3 Lenti ORF clone of Human dimethylarginine dimethylaminohydrolase 2 (DDAH2), Myc-DDK-tagged 10 ug
$750.00
RC200287L4 Lenti ORF clone of Human dimethylarginine dimethylaminohydrolase 2 (DDAH2), mGFP tagged 10 ug
$750.00
RG200287 DDAH2 (tGFP-tagged) - Human dimethylarginine dimethylaminohydrolase 2 (DDAH2) 10 ug
$489.00 MSRP $650.00 MSRP $650.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.