Destrin (DSTN) (NM_006870) Human Untagged Clone

SKU
SC319278
DSTN (untagged)-Human destrin (actin depolymerizing factor) (DSTN), transcript variant 1
$150.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Destrin
Synonyms ACTDP; ADF; bA462D18.2; HEL32
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_006870.3 GCGTTCCGTCCTGAGGCGCGCCCGCCCCGGGGTAAGCTCGCGCCGCCGCGTCAGCTCAGC
GCTGGGTCTCTCGGTCCCGCAGCCGTGAGGAGGACGGTCTGCATACTCGCTGCCCGCCGG
CTCCCTCCCCCGCGTCCCTGCGACCGCCGCGGCGAAGATGGCCTCAGGAGTGCAAGTAGC
TGATGAAGTATGTCGCATTTTTTATGACATGAAAGTTCGTAAATGCTCCACACCAGAAGA
AATCAAGAAAAGAAAGAAGGCTGTCATTTTTTGTCTCAGTGCAGACAAAAAGTGCATCAT
TGTAGAAGAAGGCAAAGAGATCTTGGTTGGAGATGTTGGTGTAACCATAACTGATCCTTT
CAAGCATTTTGTGGGAATGCTTCCTGAAAAAGATTGTCGCTATGCTTTGTATGATGCAAG
CTTTGAAACAAAAGAATCCAGAAAAGAAGAGTTGATGTTTTTTTTGTGGGCACCAGAACT
AGCACCTCTGAAAAGTAAAATGATCTATGCAAGCTCCAAGGATGCAATTAAAAAGAAATT
TCAAGGCATAAAACATGAATGTCAAGCAAATGGACCAGAAGATCTCAATCGGGCTTGTAT
TGCTGAAAAGTTAGGTGGATCCTTAATTGTAGCCTTTGAAGGATGCCCTGTGTAGATTAT
TCAGTGCCACAAATTGAAAGCTTCCATGTTTAATGTTATCCTCTTGCTATATAAATAAAG
CAAATATATTTAGGCCAGGGTCTCACTGAGGGGGAGCTGTCTTGTCATCTTTTAGAGTAA
ACTATTCTATAAACATATGCAAACAGCCCTAAATAAATCTAAAGTCTAAAGTTTTAAAAA
AAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire
ACCN NM_006870
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_006870.3, NP_006861.1
RefSeq Size 1614 bp
RefSeq ORF 498 bp
Locus ID 11034
UniProt ID P60981
Cytogenetics 20p12.1
Domains ADF
Summary The product of this gene belongs to the actin-binding proteins ADF family. This family of proteins is responsible for enhancing the turnover rate of actin in vivo. This gene encodes the actin depolymerizing protein that severs actin filaments (F-actin) and binds to actin monomers (G-actin). Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) represents the shorter transcript, but encodes the longer isoform (a).
Write Your Own Review
You're reviewing:Destrin (DSTN) (NM_006870) Human Untagged Clone
Your Rating
SKU Description Size Price
RC203419 DSTN (Myc-DDK-tagged)-Human destrin (actin depolymerizing factor) (DSTN), transcript variant 1 10 ug
$150.00
RC203419L1 Lenti ORF clone of Human destrin (actin depolymerizing factor) (DSTN), transcript variant 1, Myc-DDK-tagged 10 ug
$450.00
RC203419L2 Lenti ORF clone of Human destrin (actin depolymerizing factor) (DSTN), transcript variant 1, mGFP tagged 10 ug
$450.00
RC203419L3 Lenti ORF clone of Human destrin (actin depolymerizing factor) (DSTN), transcript variant 1, Myc-DDK-tagged 10 ug
$450.00
RC203419L4 Lenti ORF clone of Human destrin (actin depolymerizing factor) (DSTN), transcript variant 1, mGFP tagged 10 ug
$450.00
RG203419 DSTN (tGFP-tagged) - Human destrin (actin depolymerizing factor) (DSTN), transcript variant 1 10 ug
$489.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.