NAT8 (NM_003960) Human Untagged Clone

SKU
SC319260
NAT8 (untagged)-Human N-acetyltransferase 8 (GCN5-related, putative) (NAT8)
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol NAT8
Synonyms ATase2; CCNAT; CML1; GLA; Hcml1; TSC501; TSC510
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_003960.3 GGGGGAGACGGTATCTCCTGGATGCCAGTGAGCGGCTGAGAGCTGAAGCTCCCTGGACAC
TCAAGGCTCTTGTGGTGACAGTCTGACGTAAAGGCGTGCAGGGAGGCCTAGCTCTGTCTC
CTGGACTTAGAGATTTCAGACACAGAAGTCTGTCCATGGCTCCTTGTCACATCCGCAAAT
ACCAGGAGAGCGACCGCCAGTGGGTTGTGGGCTTGCTCTCCCGGGGGATGGCCGAGCATG
CCCCAGCCACCTTCCGGCAATTGCTGAAGCTGCCTCGAACCCTCATACTCTTACTTGGGG
GGCCCCTCGCCCTACTCCTGGTCTCTGGATCCTGGCTTCTAGCCCTCGTGTTCAGCATCA
GCCTCTTCCCTGCCCTGTGGTTCCTTGCCAAAAAACCCTGGACGGAGTATGTGGACATGA
CATTGTGCACAGACATGTCTGACATTACCAAATCCTACCTGAGTGAGCGTGGCTCCTGCT
TCTGGGTGGCTGAGTCTGAAGAGAAGGTGGTGGGCATGGTAGGAGCTCTGCCTGTTGATG
ATCCCACCTTGAGGGAGAAGCGGTTGCAGCTGTTTCATCTCTTTGTGGACAGTGAGCACC
GTCGTCAGGGGATAGCAAAAGCCCTGGTCAGGACTGTCCTCCAGTTTGCCCGGGACCAGG
GCTACAGTGAAGTTATCCTGGACACCGGCACCATCCAGCTCTCTGCTATGGCCCTCTACC
AGAGCATGGGCTTCAAGAAGACGGGCCAGTCCTTCTTCTGTGTGTGGGCCAGGCTAGTGG
CTCTTCATACAGTTCATTTCATCTACCACCTCCCTTCTTCTAAGGTAGGGAGTCAGTGAT
CTCTTTCTGTGTGTATTGGTCAGAATAGAATCCATTCAGCTGTAGCAGCAAGCAATCCCC
AACCTTTCACTGCAATGACCTTTCAATGCAATAAAAGCTTATTGTCCATTCAAAAAAAAA
AAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire
ACCN NM_003960
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_003960.3, NP_003951.3
RefSeq Size 1073 bp
RefSeq ORF 684 bp
Locus ID 9027
UniProt ID Q9UHE5
Cytogenetics 2p13.1
Domains Acetyltransf
Protein Families Transmembrane
Summary This gene, isolated using the differential display method to detect tissue-specific genes, is specifically expressed in kidney and liver. The encoded protein shows amino acid sequence similarity to N-acetyltransferases. A similar protein in Xenopus affects cell adhesion and gastrulation movements, and may be localized in the secretory pathway. A highly similar paralog is found in a cluster with this gene. [provided by RefSeq, Sep 2008]
Write Your Own Review
You're reviewing:NAT8 (NM_003960) Human Untagged Clone
Your Rating
SKU Description Size Price
RC203157 NAT8 (Myc-DDK-tagged)-Human N-acetyltransferase 8 (GCN5-related, putative) (NAT8) 10 ug
$300.00
RC203157L1 Lenti ORF clone of Human N-acetyltransferase 8 (GCN5-related, putative) (NAT8), Myc-DDK-tagged 10 ug
$600.00
RC203157L2 Lenti ORF clone of Human N-acetyltransferase 8 (GCN5-related, putative) (NAT8), mGFP tagged 10 ug
$600.00
RC203157L3 Lenti ORF clone of Human N-acetyltransferase 8 (GCN5-related, putative) (NAT8), Myc-DDK-tagged 10 ug
$600.00
RC203157L4 Lenti ORF clone of Human N-acetyltransferase 8 (GCN5-related, putative) (NAT8), mGFP tagged 10 ug
$600.00
RG203157 NAT8 (tGFP-tagged) - Human N-acetyltransferase 8 (GCN5-related, putative) (NAT8) 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.