OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

NAT8 (NM_003960) Human Untagged Clone

Be the first to review this product
SKU
SC319260
NAT8 (untagged)-Human N-acetyltransferase 8 (GCN5-related, putative) (NAT8)
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA500544 Anti-NAT8 mouse monoclonal antibody, clone OTI5A8 (formerly 5A8) 100 ul
$447.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "NAT8 or NM_003960"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol NAT8
Synonyms ATase2; CCNAT; CML1; GLA; Hcml1; TSC501; TSC510
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_003960.3 GGGGGAGACGGTATCTCCTGGATGCCAGTGAGCGGCTGAGAGCTGAAGCTCCCTGGACAC
TCAAGGCTCTTGTGGTGACAGTCTGACGTAAAGGCGTGCAGGGAGGCCTAGCTCTGTCTC
CTGGACTTAGAGATTTCAGACACAGAAGTCTGTCCATGGCTCCTTGTCACATCCGCAAAT
ACCAGGAGAGCGACCGCCAGTGGGTTGTGGGCTTGCTCTCCCGGGGGATGGCCGAGCATG
CCCCAGCCACCTTCCGGCAATTGCTGAAGCTGCCTCGAACCCTCATACTCTTACTTGGGG
GGCCCCTCGCCCTACTCCTGGTCTCTGGATCCTGGCTTCTAGCCCTCGTGTTCAGCATCA
GCCTCTTCCCTGCCCTGTGGTTCCTTGCCAAAAAACCCTGGACGGAGTATGTGGACATGA
CATTGTGCACAGACATGTCTGACATTACCAAATCCTACCTGAGTGAGCGTGGCTCCTGCT
TCTGGGTGGCTGAGTCTGAAGAGAAGGTGGTGGGCATGGTAGGAGCTCTGCCTGTTGATG
ATCCCACCTTGAGGGAGAAGCGGTTGCAGCTGTTTCATCTCTTTGTGGACAGTGAGCACC
GTCGTCAGGGGATAGCAAAAGCCCTGGTCAGGACTGTCCTCCAGTTTGCCCGGGACCAGG
GCTACAGTGAAGTTATCCTGGACACCGGCACCATCCAGCTCTCTGCTATGGCCCTCTACC
AGAGCATGGGCTTCAAGAAGACGGGCCAGTCCTTCTTCTGTGTGTGGGCCAGGCTAGTGG
CTCTTCATACAGTTCATTTCATCTACCACCTCCCTTCTTCTAAGGTAGGGAGTCAGTGAT
CTCTTTCTGTGTGTATTGGTCAGAATAGAATCCATTCAGCTGTAGCAGCAAGCAATCCCC
AACCTTTCACTGCAATGACCTTTCAATGCAATAAAAGCTTATTGTCCATTCAAAAAAAAA
AAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire |
ACCN NM_003960
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_003960.3, NP_003951.3
RefSeq Size 1073 bp
RefSeq ORF 684 bp
Locus ID 9027
UniProt ID Q9UHE5
Cytogenetics 2p13.1
Domains Acetyltransf
Protein Families Transmembrane
Summary This gene, isolated using the differential display method to detect tissue-specific genes, is specifically expressed in kidney and liver. The encoded protein shows amino acid sequence similarity to N-acetyltransferases. A similar protein in Xenopus affects cell adhesion and gastrulation movements, and may be localized in the secretory pathway. A highly similar paralog is found in a cluster with this gene. provided by RefSeq, Sep 2008
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_003960" in other vectors (6)
SKU Description Size Price
RC203157 NAT8 (Myc-DDK-tagged)-Human N-acetyltransferase 8 (GCN5-related, putative) (NAT8) 10 ug
$300.00
RC203157L1 Lenti ORF clone of Human N-acetyltransferase 8 (GCN5-related, putative) (NAT8), Myc-DDK-tagged 10 ug
$600.00
RC203157L2 Lenti ORF clone of Human N-acetyltransferase 8 (GCN5-related, putative) (NAT8), mGFP tagged 10 ug
$600.00
RC203157L3 Lenti ORF clone of Human N-acetyltransferase 8 (GCN5-related, putative) (NAT8), Myc-DDK-tagged 10 ug
$600.00
RC203157L4 Lenti ORF clone of Human N-acetyltransferase 8 (GCN5-related, putative) (NAT8), mGFP tagged 10 ug
$600.00
RG203157 NAT8 (tGFP-tagged) - Human N-acetyltransferase 8 (GCN5-related, putative) (NAT8) 10 ug
$489.00 $500.00

file-alt Citations

Molecular identification of NAT8 as the enzyme that acetylates cysteine S-conjugates to mercapturic acids
Veiga-da-Cunha, Tyteca, Stroobant et al
J Biol Chem (2010) 285 (24), 18888-98 DOI: 10.1074/jbc.M110.110924
AI Summary: In this study, OriGene’s human NAT8 cDNA (Cat# RC213355) was used to overexpress NAT8 in HEK293T cells, enabling the authors to characterize the enzyme’s role in acetylating cysteine S-conjugates to mercapturic acids.
Two endoplasmic reticulum (ER)/ER Golgi intermediate compartment-based lysine acetyltransferases post-translationally regulate BACE1 levels
Ko, Puglielli
J Biol Chem (2009) 284 (4), 2482-92 DOI: 10.1074/jbc.M804901200
AI Summary: In this study, OriGene products including ATase1 (OriGene Cat# RC203307) and ATase2 (OriGene Cat# RC209920) expression plasmids were used to investigate the role of these acetyltransferases in the post-translational regulation of BACE1 levels.
Showing 1-2 of 2 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products