Cystatin SN (CST1) (NM_001898) Human Untagged Clone

SKU SC319224

CST1 (untagged)-Human cystatin SN (CST1)

Product Data

• Type: Human Untagged Clone
• Target Symbol: Cystatin SN
• Vector: pCMV6-AC
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_001898.2 GCTCCCTGCCTCGGGCTCTCACCCTCCTCTCCTGCAGCTCCAGCTTTGTGCTCTGCCTCT; GAGGAGACCATGGCCCAGTATCTGAGTACCCTGCTGCTCCTGCTGGCCACCCTAGCTGTG; GCCCTGGCCTGGAGCCCCAAGGAGGAGGATAGGATAATCCCGGGTGGCATCTATAACGCA; GACCTCAATGATGAGTGGGTACAGCGTGCCCTTCACTTCGCCATCAGCGAGTATAACAAG; GCCACCAAAGATGACTACTACAGACGTCCGCTGCGGGTACTAAGAGCCAGGCAACAGACC; GTTGGGGGGGTGAATTACTTCTTCGACGTAGAGGTGGGCCGAACCATATGTACCAAGTCC; CAGCCCAACTTGGACACCTGTGCCTTCCATGAACAGCCAGAACTGCAGAAGAAACAGTTG; TGCTCTTTCGAGATCTACGAAGTTCCCTGGGAGAACAGAAGGTCCCTGGTGAAATCCAGG; TGTCAAGAATCCTAGGGATCTGTGCCAGGCCATTCGCACCAGCCACCACCCACTCCCACC; CCCTGTAGTGCTCCCACCCCTGGACTGGTGGCCCCCACCCTGCGGGAGGCCTCCCCATGT; GCCTGCGCCAAGAGACAGACAGAGAAGGCTGCAGGAGTCCTTTGTTGCTCAGCAGGGCGC; TCTGCCCTCCCTCCTTCCTTCTTGCTTCTAATAGCCCTGGTACATGGTACACACCCCCCC; ACCTCCTGCAATTAAACAGTAGCATCGCCTCCCTCTGAAAAAAAAAAAAAAAAAAAAAAA
• Restriction Sites: Please inquire
• ACCN: NM_001898
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_001898.2, NP_001889.2
• RefSeq Size: 782 bp
• RefSeq ORF: 426 bp
• Locus ID: 1469
• UniProt ID: P01037
• Cytogenetics: 20p11.21
• Domains: CY
• Summary: The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions, where they appear to provide protective functions. The cystatin locus on chromosome 20 contains the majority of the type 2 cystatin genes and pseudogenes. This gene is located in the cystatin locus and encodes a cysteine proteinase inhibitor found in saliva, tears, urine, and seminal fluid. [provided by RefSeq, Jul 2008]