ISG20 (NM_002201) Human Untagged Clone

SKU
SC319212
ISG20 (untagged)-Human interferon stimulated exonuclease gene 20kDa (ISG20)
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol ISG20
Synonyms CD25; HEM45
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_002201.4 CCTGACATGGAGCCTGCCAGCTCCGTCAGCCCTGACTCGGCCCGGAGCTGAGCTCCCCAC
CTGCCGGTAGCCCAGGAGATGGAGCAGCCCAGCCCACGTGCCCGGCCTTCCGCCCCTGAC
TTCACTTGATAACAAACTAGAAACTGAAACAGGGTCGGGATGCCGATGCCGGCTTGGAGT
TAGAGATGAGTCACCGCTGAGAGCAGCTGCAGTAGCTGAGCAGTGGCAGCAGAGAGGCAG
ACGTGAGCTGAGGGCGCAGAGGCAGGCAGCATCTCTGAGGGTCCCCAAGGAGCATGGCTG
GGAGCCGTGAGGTGGTGGCCATGGACTGCGAGATGGTGGGGCTGGGGCCCCACCGGGAGA
GTGGCCTGGCTCGTTGCAGCCTCGTGAACGTCCACGGTGCTGTGCTGTACGACAAGTTCA
TCCGGCCTGAGGGAGAGATCACCGATTACAGAACCCGGGTCAGCGGGGTCACCCCTCAGC
ACATGGTGGGGGCCACACCATTTGCCGTGGCCAGGCTAGAGATCCTGCAGCTCCTGAAAG
GCAAGCTGGTGGTGGGTCATGACCTGAAGCACGACTTCCAGGCACTGAAAGAGGACATGA
GCGGCTACACAATCTACGACACGTCCACTGACAGGCTGTTGTGGCGTGAGGCCAAGCTGG
ACCACTGCAGGCGTGTCTCCCTGCGGGTGCTGAGTGAGCGCCTCCTGCACAAGAGCATCC
AGAACAGCCTGCTTGGACACAGCTCGGTGGAAGATGCGAGGGCAACGATGGAGCTCTATC
AAATCTCCCAGAGAATCCGAGCCCGCCGAGGGCTGCCCCGCCTGGCTGTGTCAGACTGAA
GCCCCATCCAGCCCGTTCCGCAGGGACTAGAGGCTTTCGGCTTTTTGGGACAGCAACTAC
CTTGCTTTTGGAAAATACATTTTTAATAGTAAAGTGGCTCTATATTTTCTCTACGCAAAA
AAAAAAAAAAAAAA
Restriction Sites Please inquire
ACCN NM_002201
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_002201.4, NP_002192.2
RefSeq Size 974 bp
RefSeq ORF 546 bp
Locus ID 3669
UniProt ID Q96AZ6
Cytogenetics 15q26.1
Domains EXOIII
Summary Interferon-induced antiviral exoribonuclease that acts on single-stranded RNA and also has minor activity towards single-stranded DNA. Exhibits antiviral activity against RNA viruses including hepatitis C virus (HCV), hepatitis A virus (HAV) and yellow fever virus (YFV) in an exonuclease-dependent manner. May also play additional roles in the maturation of snRNAs and rRNAs, and in ribosome biogenesis.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) encodes the longest isoform (a). Variants 1, 2, and 3 all encode the same isoform (a).
Write Your Own Review
You're reviewing:ISG20 (NM_002201) Human Untagged Clone
Your Rating
SKU Description Size Price
RC203178 ISG20 (Myc-DDK-tagged)-Human interferon stimulated exonuclease gene 20kDa (ISG20) 10 ug
$300.00
RC203178L1 Lenti ORF clone of Human interferon stimulated exonuclease gene 20kDa (ISG20), Myc-DDK-tagged 10 ug
$600.00
RC203178L2 Lenti ORF clone of Human interferon stimulated exonuclease gene 20kDa (ISG20), mGFP tagged 10 ug
$600.00
RC203178L3 Lenti ORF clone of Human interferon stimulated exonuclease gene 20kDa (ISG20), Myc-DDK-tagged 10 ug
$600.00
RC203178L4 Lenti ORF clone of Human interferon stimulated exonuclease gene 20kDa (ISG20), mGFP tagged 10 ug
$600.00
RG203178 ISG20 (tGFP-tagged) - Human interferon stimulated exonuclease gene 20kDa (ISG20) 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.