DUSP2 (NM_004418) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | DUSP2 |
Synonyms | PAC-1; PAC1 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>OriGene sequence for NM_004418.2
ACCGCCACGAGAGCCCGGGACGCGGGAAAGACCGAAAGGAAGAGGAAGAGGCACCGGTGG
CCATGGGGCTGGAGGCGGCGCGCGAGCTGGAGTGCGCGGCGCTGGGCACGCTGCTGCGGG ATCCGCGGGAGGCGGAACGCACGCTGCTGCTGGACTGCCGCCCCTTCCTGGCCTTCTGCC GGCGCCACGTGCGCGCCGCGCGGCCAGTGCCTTGGAACGCGCTGCTGCGGCGCCGCGCGC GCGGCCCTCCTGCCGCCGTTCTCGCCTGCCTGCTGCCCGACCGCGCGCTGCGGACGCGCC TGGTCCGCGGGGAGCTGGCGCGGGCCGTGGTGCTGGACGAGGGCAGTGCCTCGGTGGCGG AGCTCCGGCCCGACAGCCCGGCTCATGTGCTGCTGGCCGCGCTGCTGCACGAGACCCGCG CGGGGCCCACTGCCGTGTACTTCCTGCGAGGAGGCTTCGACGGCTTCCAGGGCTGCTGTC CCGATCTGTGCTCTGAGGCCCCCGCCCCTGCGCTGCCGCCAACAGGGGACAAAACCAGCC GCTCCGACTCCAGGGCTCCTGTCTACGACCAGGGTGGCCCTGTGGAGATCTTGCCCTACC TGTTCCTGGGCAGCTGCAGTCACTCGTCAGACCTGCAGGGGCTGCAGGCCTGTGGCATCA CAGCCGTCCTCAACGTGTCCGCCAGCTGCCCCAACCACTTTGAGGGCCTTTTCCGCTACA AGAGTATCCCTGTGGAGGACAACCAGATGGTGGAGATCAGTGCCTGGTTCCAGGAGGCCA TAGGCTTCATTGACTGGGTGAAGAACAGCGGAGGCCGGGTGCTGGTGCACTGCCAGGCGG GTATCTCGCGCTCTGCCACCATCTGTCTGGCATACCTCATGCAGAGTCGCCGTGTGCGGC TGGACGAGGCCTTTGACTTCGTTAAGCAGCGCCGGGGGGTCATCTCCCCCAACTTCAGTT TCATGGGGCAGCTGCTGCAGTTTGAGACCCAGGTGCTGTGTCACTGAGGTGGTGCCCCTC TGCCTGCCTGCCCCACTGTGCTGGCAGGAGCTGACTGTGGACTGGTGGGCTCCCCTCTGG GCCAGCACAGTCCCCTCACCTCTGGCAGGGCTGCTACCTCCTCAGAGTTTCAGAAGCCCC CACATGGGGGCTCTAGGAATGCCGGCATGCTGGTCTTTCCGACCTGGTGCTCTTCTGCTG GGGGACTGAGGCTGGCCCTCATTCGGGGTCGGGAACCAAGGGTGTGTCTGCTCTTTCCCT CCCCATCCTCTGGCAGAAATCAGCTAGACGCTATACCGTGGACTCTCCCTGGTCCACCAC CATGTTGAAGCCCTTGGCAGCCTGAGAGCTCCAAGGAACAAGCTGTGACAACCAGGAGCC CTGTCTGTGGGTTCGTCTGCCCAGGGCCTGGAGCCCAAGCCCTGTGTTCCTGGGGAAGCT GGGGACTTGGGAAGTGATGGGTGTGTCATGTTGCGTGTGTCTGTCTGTGAGCCTTTCACA CCTGTGCTGGCGCTGGAAAATTATTTGTGCTCAGCTGACATTTAACACTCCCTCCCCCGC TTCCTCCTAGCCCTGTGGGCAGGGGTTGGAAACTTAGCACTTTATATTTATACAGAACAT TCAGGATATGTCAATAAAATATTGTTATATTTAAAAAACAAAAAAAAAAAAAAAAAAAAA AAAA |
Restriction Sites | Please inquire |
ACCN | NM_004418 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_004418.2, NP_004409.1 |
RefSeq Size | 1702 bp |
RefSeq ORF | 945 bp |
Locus ID | 1844 |
UniProt ID | Q05923 |
Cytogenetics | 2q11.2 |
Domains | DSPc, PTPc_motif, RHOD |
Protein Families | Druggable Genome, Phosphatase |
Protein Pathways | MAPK signaling pathway |
Summary | The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which are associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product inactivates ERK1 and ERK2, is predominantly expressed in hematopoietic tissues, and is localized in the nucleus. [provided by RefSeq, Jul 2008] |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC202878 | DUSP2 (Myc-DDK-tagged)-Human dual specificity phosphatase 2 (DUSP2) | 10 ug |
$450.00
|
|
RC202878L1 | Lenti ORF clone of Human dual specificity phosphatase 2 (DUSP2), Myc-DDK-tagged | 10 ug |
$750.00
|
|
RC202878L2 | Lenti ORF clone of Human dual specificity phosphatase 2 (DUSP2), mGFP tagged | 10 ug |
$750.00
|
|
RC202878L3 | Lenti ORF clone of Human dual specificity phosphatase 2 (DUSP2), Myc-DDK-tagged | 10 ug |
$750.00
|
|
RC202878L4 | Lenti ORF clone of Human dual specificity phosphatase 2 (DUSP2), mGFP tagged | 10 ug |
$750.00
|
|
RG202878 | DUSP2 (tGFP-tagged) - Human dual specificity phosphatase 2 (DUSP2) | 10 ug |
$650.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.