WIBG (PYM1) (NM_032345) Human Untagged Clone

SKU
SC319172
WIBG (untagged)-Human within bgcn homolog (Drosophila) (WIBG), transcript variant 1
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol WIBG
Synonyms PYM; WIBG
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_032345.1 GGGCCCAGCCCGAGGAGGCACTCAGGGTTAGGAGGTCTGGGCGAGAAGCAACTAGGGCCC
TCATCACTTCGCCGCCGAATCCCCGGCGCCGCCCAGCGGGGCAGAGCCAGGCCAGGGCCG
CCCGCCCAACCTGGTCCGCTGCCTCTTCGGCCATGGAAGCTGCCGGCAGCCCTGCGGCTA
CGGAGACAGGCAAGTATATCGCGTCAACACAGCGACCTGACGGGACCTGGCGCAAGCAGC
GGAGGGTGAAAGAAGGATATGTGCCCCAGGAGGAGGTCCCAGTATATGAAAACAAGTATG
TGAAGTTTTTCAAGAGTAAACCAGAGTTGCCCCCAGGGCTAAGCCCTGAGGCCACTGCTC
CTGTCACCCCATCCAGGCCTGAAGGTGGTGAACCAGGCCTCTCCAAGACAGCCAAACGTA
ACCTGAAGCGAAAGGAGAAGAGGCGGCAGCAGCAAGAGAAAGGAGAGGCAGAGGCCTTGA
GCAGGACTCTTGATAAGGTGTCCCTGGAAGAGACAGCCCAACTCCCCAGTGCTCCACAGG
GCTCTCGGGCAGCCCCCACAGCTGCATCTGACCAGCCTGACTCAGCTGCCACCACTGAGA
AAGCCAAGAAGATAAAGAACCTAAAGAAGAAACTCCGGCAGGTGGAAGAGCTGCAGCAGC
GGATCCAGGCTGGGGAAGTCAGCCAGCCCAGCAAAGAGCAGCTAGAAAAGCTAGCAAGGA
GGAGGGCGCTAGAAGAGGAGTTAGAGGACTTGGAGTTAGGCCTCTGAGGCCTTTGGGGAA
TAGGGAATGGACTGCAGAACAAACCGTGGGGCTCTCTGGGGTCTGGGGGAATACGGGCAA
CAGCAGTCAGGAGGGGTACCCCCCATACTGGCTTCCACCTCCTGCGGCCCAGCTCTGTCC
TCCAGAGCCTAGCGTCTCCCTCAATCCTTCCCTTTTCTTCCCAACTTCTACTTTTTGGAC
TTTCCCCCTCCCATTCCCAGTGTTCAAAATCTCAGTGACTACCCCAGGTACCTTTGCTGC
TGATTTGGGTGTCTTGTTTAAAAGAAAATCAGGTGGGTGGGAATCTCTTGGAGAACTGAG
GCTGAGGGTAGAGGGAGTATGCCCAAGTCTTGGAGTCTTGGTTCCTGTTCGCGGTGTTTA
TGGGTTATTTCCCTCTCCATCCCTCATTTTTTTTTTTTTTTTAAAAAAAGCAAAAATGAG
AATAAACACAAGTAGACATGTCAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire
ACCN NM_032345
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_032345.1, NP_115721.1
RefSeq Size 1240 bp
RefSeq ORF 615 bp
Locus ID 84305
UniProt ID Q9BRP8
Cytogenetics 12q13.2
Summary Key regulator of the exon junction complex (EJC), a multiprotein complex that associates immediately upstream of the exon-exon junction on mRNAs and serves as a positional landmark for the intron exon structure of genes and directs post-transcriptional processes in the cytoplasm such as mRNA export, nonsense-mediated mRNA decay (NMD) or translation. Acts as an EJC disassembly factor, allowing translation-dependent EJC removal and recycling by disrupting mature EJC from spliced mRNAs. Its association with the 40S ribosomal subunit probably prevents a translation-independent disassembly of the EJC from spliced mRNAs, by restricting its activity to mRNAs that have been translated. Interferes with NMD and enhances translation of spliced mRNAs, probably by antagonizing EJC functions. May bind RNA; the relevance of RNA-binding remains unclear in vivo, RNA-binding was detected by PubMed:14968132, while PubMed:19410547 did not detect RNA-binding activity independently of the EJC.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).
Write Your Own Review
You're reviewing:WIBG (PYM1) (NM_032345) Human Untagged Clone
Your Rating
SKU Description Size Price
RC202988 WIBG (Myc-DDK-tagged)-Human within bgcn homolog (Drosophila) (WIBG), transcript variant 1 10 ug
$300.00
RC202988L1 Lenti ORF clone of Human within bgcn homolog (Drosophila) (WIBG), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC202988L2 Lenti ORF clone of Human within bgcn homolog (Drosophila) (WIBG), transcript variant 1, mGFP tagged 10 ug
$600.00
RC202988L3 Lenti ORF clone of Human within bgcn homolog (Drosophila) (WIBG), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC202988L4 Lenti ORF clone of Human within bgcn homolog (Drosophila) (WIBG), transcript variant 1, mGFP tagged 10 ug
$600.00
RG202988 WIBG (tGFP-tagged) - Human within bgcn homolog (Drosophila) (WIBG), transcript variant 1 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.