Cathepsin S (CTSS) (NM_004079) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | Cathepsin S |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>OriGene sequence for NM_004079.3
TTAGAAGAGAGCCCACTAATTCAAGGACTCTTACCGTGGGAGCAACTGCTGGTTCTATCA
CAATGAAACGGCTGGTTTGTGTGCTCTTGGTGTGCTCCTCTGCAGTGGCACAGTTGCATA AAGATCCTACCCTGGATCACCACTGGCATCTCTGGAAGAAAACCTATGGCAAACAATACA AGGAAAAGAATGAAGAAGCAGTACGACGTCTCATCTGGGAAAAGAATCTAAAGTTTGTGA TGCTTCACAACCTGGAGCATTCAATGGGAATGCACTCATACGATCTGGGCATGAACCACC TGGGAGACATGACCAGTGAAGAAGTGATGTCTTTGATGAGTTCCCTGAGAGTTCCCAGCC AGTGGCAGAGAAATATCACATATAAGTCAAACCCTAATTGGATATTGCCTGATTCTGTGG ACTGGAGAGAGAAAGGGTGTGTTACTGAAGTGAAATATCAAGGTTCTTGTGGTGCTTGCT GGGCTTTCAGTGCTGTGGGGGCCCTGGAAGCACAGCTGAAGCTGAAAACAGGAAAGCTGG TGTCTCTCAGTGCCCAGAACCTGGTGGATTGCTCAACTGAAAAATATGGAAACAAAGGCT GCAATGGTGGCTTCATGACAACGGCTTTCCAGTACATCATTGATAACAAGGGCATCGACT CAGACGCTTCCTATCCCTACAAAGCCATGGATCAGAAATGTCAATATGACTCAAAATATC GTGCTGCCACATGTTCAAAGTACACTGAACTTCCTTATGGCAGAGAAGATGTCCTGAAAG AAGCTGTGGCCAATAAAGGCCCAGTGTCTGTTGGTGTAGATGCGCGTCATCCTTCTTTCT TCCTCTACAGAAGTGGTGTCTACTATGAACCATCCTGTACTCAGAATGTGAATCATGGTG TACTTGTGGTTGGCTATGGTGATCTTAATGGGAAAGAATACTGGCTTGTGAAAAACAGCT GGGGCCACAACTTTGGTGAAGAAGGATATATTCGGATGGCAAGAAATAAAGGAAATCATT GTGGGATTGCTAGCTTTCCCTCTTACCCAGAAATCTAGAGGATCTCTCCTTTTTATAACA AATCAAGAAATATGAAGCACTTTCTCTTAACTTAATTTTTCCTGCTGTATCCAGAAGAAA TAATTGTGTCATGATTAATGTGTATTTACTGTACTAATTAGAAAATATAGTTTGAGGCCG GGCACGGTGGCTCACGCCTGTAATCCCAGTACTTGGGAGGCCAAGGCAGGCATATCAACT TGAGGCCAGGAGTTAAAGAGCAGCCTGGCTAACATGGTGAAACCCCATCTCTACTAAAAA TACAAAAAATTAGCCGAGCACGGTGGTGCATGCCTGTAATCCCAGCTACTTGGGAGGCTG AGGCACGAGATTCCTTGAACCCAAGAGGTTGAGGCTATGTTGAGCTGAGATCACACCACT GTACTCCAGCCTGGATGACAGAGTGGAGACTCTGTTTCAAAAAAACAGAAAAGAAAATAT AGTTTGATTCTTCATTTTTTTAAATTTGCAAATCTCAGGATAAAGTTTGCTAAGTAAATT AGTAATGTACTATAGATATAACTGTACAAAAATTGTTCAACCTAAAACAATCTGTAATTG CTTATTGTTTTATTGTATACTCTTTGTCTTTTAAGACCCCTAATAGCCTTTTGTAACTTG ATGGCTTAAAAATACTTAATAAATCTGCCATTTCAAATTTCAAAAAAAAAAAAAAAAAAA AAA |
Restriction Sites | EcoRI-XhoI |
ACCN | NM_004079 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_004079.3, NP_004070.3 |
RefSeq Size | 4100 bp |
RefSeq ORF | 996 bp |
Locus ID | 1520 |
UniProt ID | P25774 |
Cytogenetics | 1q21.3 |
Domains | Pept_C1 |
Protein Families | Druggable Genome, Protease |
Protein Pathways | Antigen processing and presentation, Lysosome |
Summary | The preproprotein encoded by this gene, a member of the peptidase C1 family, is a lysosomal cysteine proteinase that participates in the degradation of antigenic proteins to peptides for presentation on MHC class II molecules. The mature protein cleaves the invariant chain of MHC class II molecules in endolysosomal compartments and enables the formation of antigen-MHC class II complexes and the proper display of extracellular antigenic peptides by MHC-II. The mature protein also functions as an elastase over a broad pH range. When secreted from cells, this protein can remodel components of the extracellular matrix such as elastin, collagen, and fibronectin. This gene is implicated in the pathology of many inflammatory and autoimmune diseases and, given its elastase activity, plays a significant role in some pulmonary diseases. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2020] Transcript Variant: This variant (1) encodes a longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC201215 | CTSS (Myc-DDK-tagged)-Human cathepsin S (CTSS), transcript variant 1 | 10 ug |
$450.00
|
|
RC201215L3 | Lenti ORF clone of Human cathepsin S (CTSS), transcript variant 1, Myc-DDK-tagged | 10 ug |
$750.00
|
|
RC201215L4 | Lenti ORF clone of Human cathepsin S (CTSS), transcript variant 1, mGFP tagged | 10 ug |
$750.00
|
|
RG201215 | CTSS (tGFP-tagged) - Human cathepsin S (CTSS), transcript variant 1 | 10 ug |
$650.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.