Cardiac Troponin T (TNNT2) (NM_001001431) Human Untagged Clone

SKU
SC319089
TNNT2 (untagged)-Human troponin T type 2 (cardiac) (TNNT2), transcript variant 3
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Cardiac Troponin T
Synonyms CMD1D; CMH2; CMPD2; cTnT; LVNC6; RCM3; TnTC
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_001001431.1 CTGAGCAGACGCCTCCAGGATCTGTCGGCAGCTGCTGTTCTGAGGGAGAGCAGAGACCAT
GTCTGACATAGAAGAGGTGGTGGAAGAGTACGAGGAGGAGGAGCAGGAAGAAGCAGCTGT
TGAAGAGCAGGAGGAGGCAGCGGAAGAGGATGCTGAAGCAGAGGCTGAGACCGAGGAGAC
CAGGGCAGAAGAAGATGAAGAAGAAGAGGAAGCAAAGGAGGCTGAAGATGGCCCAATGGA
GGAGTCCAAACCAAAGCCCAGGTCGTTCATGCCCAACTTGGTGCCTCCCAAGATCCCCGA
TGGAGAGAGAGTGGACTTTGATGACATCCACCGGAAGCGCATGGAGAAGGACCTGAATGA
GTTGCAGGCGCTGATCGAGGCTCACTTTGAGAACAGGAAGAAAGAGGAGGAGGAGCTCGT
TTCTCTCAAAGACAGGATCGAGAGACGTCGGGCAGAGCGGGCCGAGCAGCAGCGCATCCG
GAATGAGCGGGAGAAGGAGCGGCAGAACCGCCTGGCTGAAGAGAGGGCTCGACGAGAGGA
GGAGGAGAACAGGAGGAAGGCTGAGGATGAGGCCCGGAAGAAGAAGGCTTTGTCCAACAT
GATGCATTTTGGGGGTTACATCCAGAAGACAGAGCGGAAAAGTGGGAAGAGGCAGACTGA
GCGGGAAAAGAAGAAGAAGATTCTGGCTGAGAGGAGGAAGGTGCTGGCCATTGACCACCT
GAATGAAGATCAGCTGAGGGAGAAGGCCAAGGAGCTGTGGCAGAGCATCTATAACTTGGA
GGCAGAGAAGTTCGACCTGCAGGAGAAGTTCAAGCAGCAGAAATATGAGATCAATGTTCT
CCGAAACAGGATCAACGATAACCAGAAAGTCTCCAAGACCCGCGGGAAGGCTAAAGTCAC
CGGGCGCTGGAAATAGAGCCTGGCCTCCTTCACCAAAGATCTGCTCCTCGCTCGCACCTG
CCTCCGGCCTGCACTCCCCCAGTTCCCGGGCCCTCCTGGGCACCCCAGGCAGCTCCTGTT
TGGAAATGGGGAGCTGGCCTAGGTGGGAGCCACCACTCCTGCCTGCCCCCACACCCACTC
CACACCAGTAATAAAAAGCCACCACACAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire
ACCN NM_001001431
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001001431.1, NP_001001431.1
RefSeq Size 1123 bp
RefSeq ORF 858 bp
Locus ID 7139
UniProt ID P45379
Cytogenetics 1q32.1
Protein Families Druggable Genome
Protein Pathways Cardiac muscle contraction, Dilated cardiomyopathy, Hypertrophic cardiomyopathy (HCM)
Summary The protein encoded by this gene is the tropomyosin-binding subunit of the troponin complex, which is located on the thin filament of striated muscles and regulates muscle contraction in response to alterations in intracellular calcium ion concentration. Mutations in this gene have been associated with familial hypertrophic cardiomyopathy as well as with dilated cardiomyopathy. Transcripts for this gene undergo alternative splicing that results in many tissue-specific isoforms, however, the full-length nature of some of these variants has not yet been determined. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3) lacks multiple in-frame exons, compared to variant 5. It encodes a shorter isoform (3) compared to isoform 5.
Write Your Own Review
You're reviewing:Cardiac Troponin T (TNNT2) (NM_001001431) Human Untagged Clone
Your Rating
SKU Description Size Price
RC201218 TNNT2 (Myc-DDK-tagged)-Human troponin T type 2 (cardiac) (TNNT2), transcript variant 3 10 ug
$300.00
RC201218L1 Lenti ORF clone of Human troponin T type 2 (cardiac) (TNNT2), transcript variant 3, Myc-DDK-tagged 10 ug
$600.00
RC201218L2 Lenti ORF clone of Human troponin T type 2 (cardiac) (TNNT2), transcript variant 3, mGFP tagged 10 ug
$600.00
RC201218L3 Lenti ORF clone of Human troponin T type 2 (cardiac) (TNNT2), transcript variant 3, Myc-DDK-tagged 10 ug
$600.00
RC201218L4 Lenti ORF clone of Human troponin T type 2 (cardiac) (TNNT2), transcript variant 3, mGFP tagged 10 ug
$600.00
RG201218 TNNT2 (tGFP-tagged) - Human troponin T type 2 (cardiac) (TNNT2), transcript variant 3 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.