RPP20 (POP7) (NM_005837) Human Untagged Clone

SKU
SC319055
POP7 (untagged)-Human processing of precursor 7, ribonuclease P/MRP subunit (S. cerevisiae) (POP7)
$150.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol RPP20
Synonyms 0610037N12Rik; RPP2; RPP20
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_005837.2 CCGGCGCGGGCAGGGCGCCCACGAGCTGGCTGGCTGCTTGCACCCACATCCTTCTTTCTC
TGGGACCTGGGGTCGCGGTTACTTGGGCTGGCCGGCGAACCCTTGAGTGGCCTGGCGGGG
AGCGGGCCTCGCGCGCCTGGAGGGCCCTGTGGAACGAAGAGAGGCACACAGCATGGCAGA
AAACCGAGAGCCCCGCGGTGCTGTGGAGGCTGAACTGGATCCAGTGGAATACACCCTTAG
GAAAAGGCTTCCCAGCCGCCTGCCCCGGAGACCCAATGACATTTATGTCAACATGAAGAC
GGACTTTAAGGCCCAGCTGGCCCGCTGCCAGAAGCTGCTGGACGGAGGGGCCCGGGGTCA
GAACGCGTGCTCTGAGATCTACATTCACGGCTTGGGCCTGGCCATCAACCGCGCCATCAA
CATCGCGCTGCAGCTGCAGGCGGGCAGCTTCGGGTCCTTGCAGGTGGCTGCCAATACCTC
CACCGTGGAGCTTGTTGATGAGCTGGAGCCAGAGACCGACACACGGGAGCCACTGACTCG
GATCCGCAACAACTCAGCCATCCACATCCGAGTCTTCAGGGTCACACCCAAGTAATTGAA
AAGACACTCCTCCACTTATCCCCTCCGTGATATGGCTCTTCGCATGCTGAGTACTGGACC
TCGGACCAGAGCCATGTAAGAAAAGGCCTGTTCCCTGGAAGCCCAAAGGACTCTGCATTG
AGGGTGGGGGTAATTGTCTCTTGGTGGGCCCAGTTAGTGGGCCTTCCTGAGTGTGTGTAT
GCGGTCTGTAACTATTGCCATATAAATAAAAAATCCTGTTGCACTAGTAAAAAAAAAAAA
AAAAAA
Restriction Sites Please inquire
ACCN NM_005837
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_005837.2, NP_005828.2
RefSeq Size 949 bp
RefSeq ORF 423 bp
Locus ID 10248
UniProt ID O75817
Cytogenetics 7q22.1
Protein Families Stem cell - Pluripotency
Summary Component of ribonuclease P, a ribonucleoprotein complex that generates mature tRNA molecules by cleaving their 5'-ends (PubMed:9630247, PubMed:30454648). Also a component of the MRP ribonuclease complex, which cleaves pre-rRNA sequences (PubMed:28115465).[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:RPP20 (POP7) (NM_005837) Human Untagged Clone
Your Rating
SKU Description Size Price
RC200582 POP7 (Myc-DDK-tagged)-Human processing of precursor 7, ribonuclease P/MRP subunit (S. cerevisiae) (POP7) 10 ug
$150.00
RC200582L3 Lenti ORF clone of Human processing of precursor 7, ribonuclease P/MRP subunit (S. cerevisiae) (POP7), Myc-DDK-tagged 10 ug
$450.00
RC200582L4 Lenti ORF clone of Human processing of precursor 7, ribonuclease P/MRP subunit (S. cerevisiae) (POP7), mGFP tagged 10 ug
$450.00
RG200582 POP7 (tGFP-tagged) - Human processing of precursor 7, ribonuclease P/MRP subunit (S. cerevisiae) (POP7) 10 ug
$350.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.