TRIT1 (NM_017646) Human Untagged Clone

SKU
SC317768
TRIT1 (untagged)-Human tRNA isopentenyltransferase 1 (TRIT1)
$732.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol TRIT1
Synonyms COXPD35; GRO1; hGRO1; IPPT; IPT; IPTase; MOD5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC317768 representing NM_017646.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGTCCGTGGCGGCTGCACGAGCAGTTCCCGTGGGCAGTGGGCTCAGGGGCCTGCAACGGACCCTA
CCTCTTGTAGTGATTCTCGGGGCCACGGGCACCGGCAAATCCACGCTGGCGTTGCAGCTAGGCCAGCGG
CTCGGCGGTGAGATCGTCAGCGCTGACTCCATGCAGGTCTATGAAGGCCTAGACATCATCACCAACAAG
GTTTCTGCCCAAGAGCAGAGAATCTGCCGGCACCACATGATCAGCTTTGTGGATCCTCTTGTGACCAAT
TACACAGTGGTGGACTTCAGAAATAGAGCAACTGCTCTGATTGAAGATATATTTGCCCGAGACAAAATT
CCTATTGTTGTGGGAGGAACCAATTATTACATTGAATCTCTGCTCTGGAAAGTTCTTGTCAATACCAAG
CCCCAGGAGATGGGCACTGAGAAAGTGATTGACCGAAAAGTGGAGCTTGAAAAGGAGGATGGTCTTGTA
CTTCACAAACGCCTAAGCCAGGTGGACCCAGAAATGGCTGCCAAGCTGCATCCACATGACAAACGCAAA
GTGGCCAGGAGCTTGCAAGTTTTTGAAGAAACAGGAATCTCTCATAGTGAATTTCTCCATCGTCAACAT
ACGGAAGAAGGTGGTGGTCCCCTTGGAGGTCCTCTGAAGTTCTCTAACCCTTGCATCCTTTGGCTTCAT
GCTGACCAGGCAGTTCTAGATGAGCGCTTGGATAAGAGGGTGGATGACATGCTTGCTGCTGGGCTCTTG
GAGGAACTAAGAGATTTTCACAGACGCTATAATCAGAAGAATGTTTCGGAAAATAGCCAGGACTATCAA
CATGGTATCTTCCAATCAATTGGCTTCAAGGAATTTCACGAGTACCTGATCACTGAGGGAAAATGCACA
CTGGAGACTAGTAACCAGCTTCTAAAGAAAGGTATTGAGGCTCTGAAACAAGTAACTAAGAGATATGCC
CGGAAACAAAACCGATGGGTTAAAAACCGTTTTTTGAGCAGACCTGGTCCCATTGTCCCCCCTGTCTAT
GGCTTAGAGGTATCTGATGTCTCGAAGTGGGAAGAGTCTGTTCTTGAACCTGCTCTTGAAATCGTGCAA
AGTTTCATCCAGGGCCACAAGCCTACAGCCACTCCAATAAAGATGCCATACAATGAAGCTGAGAACAAG
AGAAGTTATCACCTGTGTGACCTCTGTGATCGAATCATCATTGGGGATCGCGAATGGGCAGCGCACATA
AAATCCAAATCCCACTTGAACCAACTGAAGAAAAGAAGAAGATTGGACTCAGATGCTGTCAACACCATA
GAAAGTCAGAGTGTTTCCCCAGACCATAACAAAGAACCTAAAGAGAAGGGATCCCCAGGGCAGAATGAT
CAAGAGCTGAAATGCAGCGTTTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_017646
Insert Size 1404 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_017646.5
RefSeq Size 2159 bp
RefSeq ORF 1404 bp
Locus ID 54802
UniProt ID Q9H3H1
Cytogenetics 1p34.2
Domains IPPT, ZnF_U1
Protein Pathways Metabolic pathways
MW 52.7 kDa
Summary This gene encodes a protein that that is targeted to the mitochondrion and modifies transfer RNAs (tRNAs) by adding a dimethylallyl group onto the adenine at position 37. This modification is important for maintaining the correct reading frame during protein translation. This gene is considered a tumor suppressor and its expression can decrease cell growth. Alternative splicing results in multiple transcripts variants, most of which are likely non-functional. [provided by RefSeq, Aug 2015]
Transcript Variant: This variant (1) encodes the longest functional protein (isoform 1).
Write Your Own Review
You're reviewing:TRIT1 (NM_017646) Human Untagged Clone
Your Rating
SKU Description Size Price
RC210476 TRIT1 (Myc-DDK-tagged)-Human tRNA isopentenyltransferase 1 (TRIT1) 10 ug
$686.00
RC210476L1 Lenti ORF clone of Human tRNA isopentenyltransferase 1 (TRIT1), Myc-DDK-tagged 10 ug
$986.00
RC210476L2 Lenti ORF clone of Human tRNA isopentenyltransferase 1 (TRIT1), mGFP tagged 10 ug
$986.00
RC210476L3 Lenti ORF clone of Human tRNA isopentenyltransferase 1 (TRIT1), Myc-DDK-tagged 10 ug
$986.00
RC210476L4 Lenti ORF clone of Human tRNA isopentenyltransferase 1 (TRIT1), mGFP tagged 10 ug
$986.00
RG210476 TRIT1 (tGFP-tagged) - Human tRNA isopentenyltransferase 1 (TRIT1) 10 ug
$886.00
SC114027 TRIT1 (untagged)-Human tRNA isopentenyltransferase 1 (TRIT1) 10 ug
$450.00
SC321144 TRIT1 (untagged)-Human tRNA isopentenyltransferase 1 (TRIT1) 10 ug
$686.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.