MST3 (STK24) (NM_003576) Human Untagged Clone

SKU
SC317726
STK24 (untagged)-Human serine/threonine kinase 24 (STK24), transcript variant 1
$686.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol MST3
Synonyms HEL-S-95; MST3; MST3B; STE20; STK3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC317726 representing NM_003576.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGACTCCAGAGCCCAGCTTTGGGGACTGGCCTTGAATAAAAGGAGGGCCACTCTACCTCATCCTGGA
GGGAGCACGAACCTAAAGGCAGACCCAGAAGAGCTTTTTACAAAACTAGAGAAAATTGGGAAGGGCTCC
TTTGGAGAGGTGTTCAAAGGCATTGACAATCGGACTCAGAAAGTGGTTGCCATAAAGATCATTGATCTG
GAAGAAGCTGAAGATGAGATAGAGGACATTCAACAAGAAATCACAGTGCTGAGTCAGTGTGACAGTCCA
TATGTAACCAAATATTATGGATCCTATCTGAAGGATACAAAATTATGGATAATAATGGAATATCTTGGT
GGAGGCTCCGCACTAGATCTATTAGAACCTGGCCCATTAGATGAAACCCAGATCGCTACTATATTAAGA
GAAATACTGAAAGGACTCGATTATCTCCATTCGGAGAAGAAAATCCACAGAGACATTAAAGCGGCCAAC
GTCCTGCTGTCTGAGCATGGCGAGGTGAAGCTGGCGGACTTTGGCGTGGCTGGCCAGCTGACAGACACC
CAGATCAAAAGGAACACCTTCGTGGGCACCCCATTCTGGATGGCACCCGAGGTCATCAAACAGTCGGCC
TATGACTCGAAGGCAGACATCTGGTCCCTGGGCATAACAGCTATTGAACTTGCAAGAGGGGAACCACCT
CATTCCGAGCTGCACCCCATGAAAGTTTTATTCCTCATTCCAAAGAACAACCCACCGACGTTGGAAGGA
AACTACAGTAAACCCCTCAAGGAGTTTGTGGAGGCCTGTTTGAATAAGGAGCCGAGCTTTAGACCCACT
GCTAAGGAGTTATTGAAGCACAAGTTTATACTACGCAATGCAAAGAAAACTTCCTACTTGACCGAGCTC
ATCGACAGGTACAAGAGATGGAAGGCCGAGCAGAGCCATGACGACTCGAGCTCCGAGGATTCCGACGCG
GAAACAGATGGCCAAGCCTCGGGGGGCAGTGATTCTGGGGACTGGATCTTCACAATCCGAGAAAAAGAT
CCCAAGAATCTCGAGAATGGAGCTCTTCAGCCATCGGACTTGGACAGAAATAAGATGAAAGACATCCCA
AAGAGGCCTTTCTCTCAGTGTTTATCTACAATTATTTCTCCTCTGTTTGCAGAGTTGAAGGAGAAGAGC
CAGGCGTGCGGAGGGAACTTGGGGTCCATTGAAGAGCTGCGAGGGGCCATCTACCTAGCGGAGGAGGCG
TGCCCTGGCATCTCCGACACCATGGTGGCCCAGCTCGTGCAGCGGCTCCAGAGATACTCTCTAAGTGGT
GGAGGAACTTCATCCCACTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_003576
Insert Size 1332 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_003576.4
RefSeq Size 4579 bp
RefSeq ORF 1332 bp
Locus ID 8428
UniProt ID Q9Y6E0
Cytogenetics 13q32.2
Domains pkinase, S_TKc, TyrKc
Protein Families Druggable Genome, Protein Kinase
MW 49.3 kDa
Summary This gene encodes a serine/threonine protein kinase that functions upstream of mitogen-activated protein kinase (MAPK) signaling. The encoded protein is cleaved into two chains by caspases; the N-terminal fragment (MST3/N) translocates to the nucleus and promotes programmed cells death. There is a pseudogene for this gene on chromosome X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2013]
Transcript Variant: This variant (1) encodes the longest isoform (a, also known as MST3b). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:MST3 (STK24) (NM_003576) Human Untagged Clone
Your Rating
SKU Description Size Price
RC217776 STK24 (Myc-DDK-tagged)-Human serine/threonine kinase 24 (STK24), transcript variant 1 10 ug
$686.00
RC217776L1 Lenti-ORF clone of STK24 (Myc-DDK-tagged)-Human serine/threonine kinase 24 (STK24), transcript variant 1 10 ug
$986.00
RC217776L2 Lenti-ORF clone of STK24 (mGFP-tagged)-Human serine/threonine kinase 24 (STK24), transcript variant 1 10 ug
$986.00
RC217776L3 Lenti-ORF clone of STK24 (Myc-DDK-tagged)-Human serine/threonine kinase 24 (STK24), transcript variant 1 10 ug
$986.00
RC217776L4 Lenti-ORF clone of STK24 (mGFP-tagged)-Human serine/threonine kinase 24 (STK24), transcript variant 1 10 ug
$986.00
RG217776 STK24 (tGFP-tagged) - Human serine/threonine kinase 24 (STK24), transcript variant 1 10 ug
$886.00
SC117907 STK24 (untagged)-Human serine/threonine kinase 24 (STK24), transcript variant 1 10 ug
$686.00
SC323356 STK24 (untagged)-Kinase deficient mutant (K65M) of Human serine/threonine kinase 24 (STE20 homolog, yeast) (STK24), transcript variant 1 10 ug
$686.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.