PSMC3 (NM_002804) Human Untagged Clone

SKU
SC317718
PSMC3 (untagged)-Human proteasome (prosome, macropain) 26S subunit, ATPase, 3 (PSMC3)
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol PSMC3
Synonyms DCIDP; RPT5; TBP1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC317718 representing NM_002804.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAATCTGCTGCCGAATATTGAGAGTCCAGTGACTCGGCAGGAGAAGATGGCGACCGTGTGGGATGAG
GCCGAGCAAGATGGAATTGGGGAGGAGGTGCTCAAGATGTCCACGGAGGAGATCATCCAGCGCACACGG
CTGCTGGACAGTGAGATCAAGATCATGAAGAGTGAAGTGTTGAGAGTCACCCATGAGCTCCAAGCCATG
AAGGACAAGATAAAAGAGAACAGTGAGAAAATCAAAGTGAACAAGACCCTGCCGTACCTTGTCTCCAAC
GTCATCGAGCTCCTGGATGTTGATCCTAATGACCAAGAGGAGGATGGTGCCAATATTGACCTGGACTCC
CAGAGGAAGGGCAAGTGTGCTGTGATCAAAACCTCTACACGACAGACGTACTTCCTTCCTGTGATTGGG
TTGGTGGATGCTGAAAAGCTAAAGCCAGGAGACCTGGTGGGTGTGAACAAAGACTCCTATCTGATCCTG
GAGACGCTGCCCACAGAGTATGACTCGCGGGTGAAGGCCATGGAGGTAGACGAGAGGCCCACGGAGCAA
TACAGTGACATTGGGGGTTTGGACAAGCAGATCCAGGAGCTGGTGGAGGCCATTGTCTTGCCAATGAAC
CACAAGGAGAAGTTTGAGAACTTGGGGATCCAACCTCCAAAAGGGGTGCTGATGTATGGGCCCCCAGGG
ACGGGGAAGACCCTCCTGGCCCGGGCCTGTGCCGCACAGACTAAGGCCACCTTCCTAAAGCTGGCTGGC
CCCCAGCTGGTGCAGATGTTCATTGGAGATGGTGCCAAGCTAGTCCGGGATGCCTTTGCCCTGGCCAAG
GAGAAAGCGCCCTCTATCATCTTCATTGATGAGTTGGATGCCATCGGCACCAAGCGCTTTGACAGTGAG
AAGGCTGGGGACCGGGAGGTGCAGAGGACAATGCTGGAGCTTCTGAACCAGCTGGATGGCTTCCAGCCC
AACACCCAAGTTAAGGTAATTGCAGCCACAAACAGGGTGGACATCCTGGACCCCGCCCTCCTCCGCTCG
GGCCGCCTTGACCGCAAGATAGAGTTCCCGATGCCCAATGAGGAGGCCCGGGCCAGAATCATGCAGATC
CACTCCCGAAAGATGAATGTCAGTCCTGACGTGAACTACGAGGAGCTGGCCCGCTGCACAGATGACTTC
AATGGGGCCCAGTGCAAGGCTGTGTGTGTGGAGGCGGGCATGATCGCACTGCGCAGGGGTGCCACGGAG
CTCACCCACGAGGACTACATGGAAGGCATCCTGGAGGTGCAGGCCAAGAAGAAAGCCAACCTACAATAC
TACGCCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_002804
Insert Size 1320 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_002804.4
RefSeq Size 1618 bp
RefSeq ORF 1320 bp
Locus ID 5702
UniProt ID P17980
Cytogenetics 11p11.2
Domains AAA
Protein Families Druggable Genome, Transcription Factors
Protein Pathways Proteasome
MW 49.2 kDa
Summary The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the ATPase subunits, a member of the triple-A family of ATPases that have chaperone-like activity. This subunit may compete with PSMC2 for binding to the HIV tat protein to regulate the interaction between the viral protein and the transcription complex. A pseudogene has been identified on chromosome 9. [provided by RefSeq, Jul 2008]
Write Your Own Review
You're reviewing:PSMC3 (NM_002804) Human Untagged Clone
Your Rating
SKU Description Size Price
RC201790 PSMC3 (Myc-DDK-tagged)-Human proteasome (prosome, macropain) 26S subunit, ATPase, 3 (PSMC3) 10 ug
$457.00
RC201790L1 Lenti ORF clone of Human proteasome (prosome, macropain) 26S subunit, ATPase, 3 (PSMC3), Myc-DDK-tagged 10 ug
$757.00
RC201790L2 Lenti ORF clone of Human proteasome (prosome, macropain) 26S subunit, ATPase, 3 (PSMC3), mGFP tagged 10 ug
$757.00
RC201790L3 Lenti ORF clone of Human proteasome (prosome, macropain) 26S subunit, ATPase, 3 (PSMC3), Myc-DDK-tagged 10 ug
$757.00
RC201790L4 Lenti ORF clone of Human proteasome (prosome, macropain) 26S subunit, ATPase, 3 (PSMC3), mGFP tagged 10 ug
$757.00
RG201790 PSMC3 (tGFP-tagged) - Human proteasome (prosome, macropain) 26S subunit, ATPase, 3 (PSMC3) 10 ug
$489.00 MSRP $657.00 MSRP $657.00
SC108209 PSMC3 (untagged)-Human proteasome (prosome, macropain) 26S subunit, ATPase, 3 (PSMC3) 10 ug
$457.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.