TRIOBP (NM_138632) Human Untagged Clone

SKU
SC317694
TRIOBP (untagged)-Human TRIO and F-actin binding protein (TRIOBP), transcript variant 2
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol TRIOBP
Synonyms DFNB28; dJ37E16.4; HRIHFB2122; TAP68; TARA
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC317694 representing NM_138632.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGCGGATGGAAGGGGCCGGGGCAGCGTCGGGGAAAGGAAGGGCCGGAGGCGCGGCGGCGGGCGGCC
GAGAGGGGCGGCGGCGGCGGCGGCGGCGGGGTTCCCGCGCCGCGGAGCCCGGCCCGAGAGCCGCGTCCA
CGTTCCTGCCTCCTGCTCCCGCCGCCCTGGGGCGCCGCCATGACGCCCGATCTGCTCAACTTCAAGAAG
GGATGGATGTCGATCTTGGACGAGCCTGGAGAGCCTCCCTCCCCCTCGCTCACCACCACCTCTACTTCG
CAGTGGAAGAAACATTGGTTTGTGCTGACAGATTCAAGTCTCAAATATTACAGAGACTCCACTGCTGAG
GAGGCAGATGAGCTGGATGGTGAGATCGACCTGCGTTCCTGCACGGATGTCACTGAGTACGCGGTGCAG
CGCAACTATGGCTTCCAGATCCACACCAAGGATGCTGTCTATACCTTGTCGGCCATGACCTCAGGCATC
CGGCGGAACTGGATCGAGGCTCTGAGAAAGACCGTACGTCCAACTTCAGCCCCAGATGTCACCAAGCTC
TCGGACTCTAACAAGGAGAACGCGCTGCACAGCTACAGCACCCAGAAGGGCCCCCTGAAGGCAGGGGAG
CAGCGGGCGGGCTCTGAGGTCATCAGCCGGGGTGGCCCTCGGAAGGCGGACGGGCAGCGTCAGGCCTTG
GACTACGTGGAGCTCTCGCCGCTGACCCAGGCTTCCCCGCAGCGGGCCCGCACCCCAGCCCGCACTCCT
GACCGCCTGGCCAAGCAGGAGGAGCTGGAGCGGGACCTGGCCCAGCGCTCCGAGGAGCGGCGCAAGTGG
TTTGAGGCCACAGACAGCAGGACCCCAGAGGTGCCTGCTGGTGAGGGGCCGCGCCGGGGCCTGGGTGCC
CCCCTGACTGAGGACCAGCAAAACCGGCTTAGTGAGGAGATCGAGAAGAAGTGGCAGGAGCTGGAGAAG
CTGCCCCTGCGGGAGAATAAGCGGGTGCCCCTCACTGCCCTGCTCAACCAAAGCCGCGGAGAGCGCCGA
GGGCCCCCAAGTGACGGCCACGAGGCACTGGAGAAGGAGGTTCAGGCTCTTCGGGCCCAGCTGGAGGCG
TGGCGTCTCCAAGGGGAGGCTCCTCAGAGTGCACTGAGATCCCAGGAGGATGGCCACATCCCCCCGGGC
TACATCTCACAGCTGGTGGGCGTGATCACTGTGCCCGTTTTACAGACAAGGCCACTGAGCTCTGAGAGG
TTATGTGACTTGCCCAAGGTCACCCCGCCTGCAGGTCTCAAAGGTGGGATTTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_138632
Insert Size 1296 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_138632.2
RefSeq Size 1743 bp
RefSeq ORF 1296 bp
Locus ID 11078
UniProt ID Q9H2D6
Cytogenetics 22q13.1
Domains PH
MW 47.6 kDa
Summary This gene encodes a protein with an N-terminal pleckstrin homology domain and a C-terminal coiled-coil region. The protein interacts with trio, which is involved with neural tissue development and controlling actin cytoskeleton organization, cell motility and cell growth. The protein also associates with F-actin and stabilizes F-actin structures. Mutations in this gene have been associated with a form of autosomal recessive nonsyndromic deafness. Multiple alternatively spliced transcript variants that would encode different isoforms have been found for this gene, however some transcripts may be subject to nonsense-mediated decay (NMD). [provided by RefSeq, Nov 2008]
Transcript Variant: This variant (2) differs in the 5' UTR, 3' UTR, and coding region (compared to variant 6), resulting in a protein that has shorter and distinct N- and C-termini when it is compared to isoform 6.
Write Your Own Review
You're reviewing:TRIOBP (NM_138632) Human Untagged Clone
Your Rating
SKU Description Size Price
RC224094 TRIOBP (Myc-DDK-tagged)-Human TRIO and F-actin binding protein (TRIOBP), transcript variant 2 10 ug
$457.00
RC224094L3 Lenti ORF clone of Human TRIO and F-actin binding protein (TRIOBP), transcript variant 2, Myc-DDK-tagged 10 ug
$757.00
RC224094L4 Lenti ORF clone of Human TRIO and F-actin binding protein (TRIOBP), transcript variant 2, mGFP tagged 10 ug
$757.00
RG224094 TRIOBP (tGFP-tagged) - Human TRIO and F-actin binding protein (TRIOBP), transcript variant 2 10 ug
$657.00
SC110217 TRIOBP (untagged)-Human TRIO and F-actin binding protein (TRIOBP), transcript variant 2 10 ug
$541.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.