VPS13B (NM_181661) Human Untagged Clone

SKU
SC317665
VPS13B (untagged)-Human vacuolar protein sorting 13 homolog B (yeast) (VPS13B), transcript variant 4
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol VPS13B
Synonyms CHS1; COH1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC317665 representing NM_181661.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCTGGAGTCATATGTAACTCCAATTTTAATGAGCTATGTGAATCGCTACATCAAGAACTTAAAGCCG
TCGGATCTACAGCTTTCACTATGGGGTGGAGACGTGGTACTCAGCAAGCTCGAGTTAAAGTTGGATGTG
CTGGAACAGGAACTGAAATTACCATTCACTTTTTTAAGTGGACATATTCATGAATTGAGGATTCATGTA
CCATGGACAAAACTGGGTTCAGAACCAGTGGTAATTACCATCAATACTATGGAATGCATTTTGAAACTT
AAGGATGGGATACAGGATGACCATGAAAGCTGTGGTTCTAATTCTACCAACCGTAGTACTGCTGAGAGC
ACAAAATCATCAATCAAACCGCGGAGAATGCAGCAGGCTGCTCCTACAGATCCTGACTTACCACCAGGT
TATGTGCAGAGTCTGATTAGACGAGTTGTAAATAATGTAAACATTGTGATAAATAATCTCATACTAAAA
TATGTTGAAGATGATATCGTCCTTTCCGTCAATATCACTTCTGCAGAATGTTATACAGTAGGTGAATTA
TGGGATCGTGCATTCATGGATATTTCTGCAACTGATTTGGTGCTGAGAAAGGTTATCAATTTTTCTGAC
TGTACAGTTTGTCTTGATAAACGGAATGCCAGTGGTAAAATAGAATTTTACCAGGATCCTTTATTATAC
AAATGTTCCTTCAGAACTCGTCTTCATTTTACATATGAAAACCTAAATTCCAAGATGCCATCTGTTATT
AAAATTCATACTTTAGTGGAAAGTTTGAAACTTTCTATCACAGATCAACAACTGCCTATGTTTATTCGT
ATAATGCAACTTGGAATTGCTCTTTACTATGGAGAAATAGGCAATTTTAAAGAAGGCGAAATAGAGGAC
CTTACTTGTCATAATAAAGATATGCTAGGAAACATTACAGGTTCTGAAGATGAAACAAGAATAGATATG
CAATATCCTGCTCAGCATAAAGGTCAAGAGTTATATTCACAGCAAGATGAGGAGCAGCCACAGGGATGG
GTGTCATGGGCCTGGTCCTTTGTGCCTGCAATTGTGAGTTATGACGATGGCGAGGAAGACTTTGTTGGG
AACGATCCTGCATCAACCATGCATCAACAAAAAGCACAGACTTTGAAGGATCCTATTGTTTCTATAGGA
TTTTATTGCACAAAGGCAACGGTGACTTTCAAAGTAGGTCTTTTCTCTTGCTGTTTATATCTCTATCAA
CTTTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_181661
Insert Size 1248 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_181661.2
RefSeq Size 1634 bp
RefSeq ORF 1248 bp
Locus ID 157680
UniProt ID Q7Z7G8
Cytogenetics 8q22.2
MW 47.2 kDa
Summary This gene encodes a potential transmembrane protein that may function in vesicle-mediated transport and sorting of proteins within the cell. This protein may play a role in the development and the function of the eye, hematological system, and central nervous system. Mutations in this gene have been associated with Cohen syndrome. Multiple splice variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (4) uses an alternate splice site in the coding region, which results in introduction of a stop codon, compared to variant 5. The resulting isoform (4) has a shorter and distinct C-terminus, compared to isoform 5. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:VPS13B (NM_181661) Human Untagged Clone
Your Rating
SKU Description Size Price
RC219188 VPS13B (Myc-DDK-tagged)-Human vacuolar protein sorting 13 homolog B (yeast) (VPS13B), transcript variant 4 10 ug
$457.00
RC219188L3 Lenti ORF clone of Human vacuolar protein sorting 13 homolog B (yeast) (VPS13B), transcript variant 4, Myc-DDK-tagged 10 ug
$757.00
RC219188L4 Lenti ORF clone of Human vacuolar protein sorting 13 homolog B (yeast) (VPS13B), transcript variant 4, mGFP tagged 10 ug
$757.00
RG219188 VPS13B (tGFP-tagged) - Human vacuolar protein sorting 13 homolog B (yeast) (VPS13B), transcript variant 4 10 ug
$657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.