SIRPG (NM_018556) Human Untagged Clone

SKU
SC317621
SIRPG (untagged)-Human signal-regulatory protein gamma (SIRPG), transcript variant 1
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol SIRPG
Synonyms bA77C3.1; CD172g; SIRP-B2; SIRPB2; SIRPgamma
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC317621 representing NM_018556.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCCTGTCCCAGCCTCCTGGCCCCATCCTCCTGGTCCTTTCCTGCTTCTGACTCTACTGCTGGGACTT
ACAGAAGTGGCAGGTGAGGAGGAGCTACAGATGATTCAGCCTGAGAAGCTCCTGTTGGTCACAGTTGGA
AAGACAGCCACTCTGCACTGCACTGTGACCTCCCTGCTTCCCGTGGGACCCGTCCTGTGGTTCAGAGGA
GTTGGACCAGGCCGGGAATTAATCTACAATCAAAAAGAAGGCCACTTCCCCAGGGTAACAACAGTTTCA
GACCTCACAAAGAGAAACAACATGGACTTTTCCATCCGCATCAGTAGCATCACCCCAGCAGATGTCGGC
ACATACTACTGTGTGAAGTTTCGAAAAGGGAGCCCTGAGAACGTGGAGTTTAAGTCTGGACCAGGCACT
GAGATGGCTTTGGGTGCCAAACCCTCTGCCCCCGTGGTATTGGGCCCTGCGGCGAGGACCACACCTGAG
CATACAGTGAGTTTCACCTGTGAGTCCCATGGCTTCTCTCCCAGAGACATCACCCTGAAATGGTTCAAA
AATGGGAATGAGCTCTCAGACTTCCAGACCAACGTGGACCCCACAGGACAGAGTGTGGCCTACAGCATC
CGCAGCACAGCCAGGGTGGTACTGGACCCCTGGGACGTTCGCTCTCAGGTCATCTGCGAGGTGGCCCAT
GTCACCTTGCAGGGGGACCCTCTTCGTGGGACTGCCAACTTGTCTGAGGCCATCCGAGTTCCACCCACC
TTGGAGGTTACTCAACAGCCCATGAGGGTGGGGAACCAGGTAAACGTCACCTGCCAGGTGAGGAAGTTC
TACCCCCAGAGCCTACAGCTGACCTGGTCGGAGAATGGAAACGTGTGCCAGAGAGAAACAGCCTCGACC
CTTACAGAGAACAAGGATGGTACCTACAACTGGACAAGCTGGTTCCTGGTGAACATATCTGACCAAAGG
GATGATGTGGTCCTCACCTGCCAGGTGAAGCATGATGGGCAGCTGGCGGTCAGCAAACGCCTTGCCCTA
GAGGTCACAGTCCACCAGAAGGACCAGAGCTCAGATGCTACCCCTGGCCCGGCATCATCCCTTACTGCG
CTGCTCCTCATAGCTGTCCTCCTGGGCCCCATCTACGTCCCCTGGAAGCAGAAGACCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_018556
Insert Size 1164 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_018556.3
RefSeq Size 1720 bp
RefSeq ORF 1164 bp
Locus ID 55423
UniProt ID Q9P1W8
Cytogenetics 20p13
Protein Families Druggable Genome, Transmembrane
MW 42.5 kDa
Summary The protein encoded by this gene is a member of the signal-regulatory protein (SIRP) family, and also belongs to the immunoglobulin superfamily. SIRP family members are receptor-type transmembrane glycoproteins known to be involved in the negative regulation of receptor tyrosine kinase-coupled signaling processes. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1).
Write Your Own Review
You're reviewing:SIRPG (NM_018556) Human Untagged Clone
Your Rating
SKU Description Size Price
RC209468 SIRPG (Myc-DDK-tagged)-Human signal-regulatory protein gamma (SIRPG), transcript variant 1 10 ug
$686.00
RC209468L1 Lenti ORF clone of Human signal-regulatory protein gamma (SIRPG), transcript variant 1, Myc-DDK-tagged 10 ug
$986.00
RC209468L2 Lenti ORF clone of Human signal-regulatory protein gamma (SIRPG), transcript variant 1, mGFP tagged 10 ug
$986.00
RC209468L3 Lenti ORF clone of Human signal-regulatory protein gamma (SIRPG), transcript variant 1, Myc-DDK-tagged 10 ug
$986.00
RC209468L4 Lenti ORF clone of Human signal-regulatory protein gamma (SIRPG), transcript variant 1, mGFP tagged 10 ug
$986.00
RG209468 SIRPG (tGFP-tagged) - Human signal-regulatory protein gamma (SIRPG), transcript variant 1 10 ug
$886.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.