PPM1L (NM_139245) Human Untagged Clone

SKU
SC317574
PPM1L (untagged)-Human protein phosphatase, Mg2+/Mn2+ dependent, 1L (PPM1L)
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol PPM1L
Synonyms PP2C-epsilon; PP2CE; PPM1-LIKE
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC317574 representing NM_139245.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGATAGAGGATACAATGACTTTGCTGTCTCTGCTGGGTCGCATCATGCGCTACTTCTTGCTGAGACCC
GAGACGCTTTTCCTGCTGTGCATCAGCTTGGCTCTATGGAGTTACTTCTTCCACACCGACGAGGTGAAG
ACCATCGTGAAGTCCAGCCGGGACGCCGTGAAGATGGTGAAGGGCAAGGTAGCCGAGATCATGCAGAAC
GATCGACTCGGGGGGCTTGATGTGCTCGAGGCCGAGTTTTCCAAGACCTGGGAGTTCAAGAACCACAAC
GTGGCGGTGTACTCCATCCAGGGCCGGAGAGACCACATGGAGGACCGCTTCGAAGTTCTCACGGATCTG
GCCAACAAGACGCACCCGTCCATCTTCGGGATCTTCGACGGGCACGGGGGAGAGACTGCAGCTGAATAT
GTAAAATCTCGACTCCCAGAGGCCCTTAAACAGCATCTTCAGGACTACGAGAAAGACAAAGAAAATAGT
GTATTATCTTACCAGACCATCCTTGAACAGCAGATTTTGTCAATTGACCGAGAAATGCTAGAAAAATTG
ACTGTATCCTATGATGAAGCAGGCACAACGTGTTTGATTGCTCTGCTATCAGATAAAGACCTCACTGTG
GCCAACGTGGGTGACTCGCGCGGGGTCCTGTGTGACAAAGATGGGAACGCTATTCCTTTGTCTCATGAT
CACAAGCCTTACCAGTTGAAGGAAAGAAAGAGGATAAAGAGAGCAGGTGGTTTCATCAGTTTCAATGGC
TCCTGGAGGGTCCAGGGAATCCTGGCCATGTCTCGGTCCCTGGGGGATTATCCGCTGAAAAATCTCAAC
GTGGTCATCCCAGACCCAGACATCCTGACCTTTGACCTGGACAAGCTTCAGCCTGAGTTCATGATCTTG
GCATCAGATGGTCTCTGGGATGCTTTCAGCAATGAAGAAGCAGTTCGATTCATCAAGGAGCGCTTGGAT
GAACCTCACTTTGGGGCCAAGAGCATAGTTTTACAGTCATTTTACAGAGGCTGCCCTGACAATATAACA
GTCATGGTGGTGAAGTTCAGAAATAGCAGCAAAACAGAAGAGCAGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_139245
Insert Size 1083 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_139245.3
RefSeq Size 10945 bp
RefSeq ORF 1083 bp
Locus ID 151742
UniProt ID Q5SGD2
Cytogenetics 3q25.33-q26.1
Domains PP2C
Protein Families Druggable Genome, Phosphatase
MW 41.1 kDa
Summary The protein encoded by this gene is a magnesium or manganese-requiring phosphatase that is involved in several signaling pathways. The encoded protein downregulates apoptosis signal-regulating kinase 1, a protein that initiates a signaling cascade that leads to apoptosis when cells are subjected to cytotoxic stresses. This protein also is an endoplasmic reticulum transmembrane protein that helps regulate ceramide transport from the endoplasmic reticulum to the Golgi apparatus. Finally, this gene may be involved in adiposity since it is upregulated in adipose tissues. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:PPM1L (NM_139245) Human Untagged Clone
Your Rating
SKU Description Size Price
RC218909 PPM1L (Myc-DDK-tagged)-Human protein phosphatase, Mg2+/Mn2+ dependent, 1L (PPM1L) 10 ug
$457.00
RC218909L1 Lenti ORF clone of Human protein phosphatase, Mg2+/Mn2+ dependent, 1L (PPM1L), Myc-DDK-tagged 10 ug
$757.00
RC218909L2 Lenti ORF clone of Human protein phosphatase, Mg2+/Mn2+ dependent, 1L (PPM1L), mGFP tagged 10 ug
$757.00
RC218909L3 Lenti ORF clone of Human protein phosphatase, Mg2+/Mn2+ dependent, 1L (PPM1L), Myc-DDK-tagged 10 ug
$757.00
RC218909L4 Lenti ORF clone of Human protein phosphatase, Mg2+/Mn2+ dependent, 1L (PPM1L), mGFP tagged 10 ug
$757.00
RG218909 PPM1L (tGFP-tagged) - Human protein phosphatase, Mg2+/Mn2+ dependent, 1L (PPM1L) 10 ug
$489.00 MSRP $657.00 MSRP $657.00
SC125344 PPM1L (untagged)-Human protein phosphatase, Mg2+/Mn2+ dependent, 1L (PPM1L) 10 ug
$300.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.