HEXO (ERI1) (NM_153332) Human Untagged Clone

SKU
SC317546
ERI1 (untagged)-Human exoribonuclease 1 (ERI1)
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol HEXO
Synonyms 3'HEXO; HEXO; THEX1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC317546 representing NM_153332.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAGGATCCACAGAGTAAAGAGCCTGCCGGCGAGGCCGTGGCTCTCGCGCTGCTGGAGTCGCCGCGG
CCGGAGGGCGGGGAGGAGCCGCCGCGTCCCAGTCCCGAGGAAACTCAACAGTGTAAATTTGATGGCCAG
GAGACAAAAGGATCCAAGTTCATTACCTCCAGTGCGAGTGACTTCAGTGACCCGGTTTACAAAGAGATT
GCCATTACGAATGGCTGTATTAATAGAATGAGTAAGGAAGAACTCAGAGCTAAGCTTTCAGAATTCAAG
CTTGAAACTAGAGGAGTAAAGGATGTTCTAAAGAAGAGACTGAAAAACTATTATAAGAAGCAGAAGCTG
ATGCTGAAAGAGAGCAATTTTGCTGACAGTTATTATGACTACATTTGTATTATTGACTTTGAAGCCACT
TGTGAAGAAGGAAACCCACCTGAGTTTGTACATGAAATAATTGAATTTCCGGTTGTTTTACTGAATACG
CATACTTTAGAAATAGAAGACACGTTTCAGCAGTATGTAAGACCAGAGATTAACACACAGCTGTCTGAT
TTCTGCATCAGTCTAACTGGAATTACTCAGGATCAGGTAGACAGAGCTGATACCTTCCCTCAGGTACTA
AAAAAAGTAATTGACTGGATGAAATTGAAGGAATTAGGAACAAAGTATAAATACTCACTTTTAACAGAT
GGTTCTTGGGATATGAGTAAGTTCTTGAACATTCAGTGTCAACTCAGCAGGCTCAAATACCCTCCTTTT
GCGAAAAAGTGGATCAATATTCGGAAGTCATATGGAAATTTTTACAAGGTTCCTAGAAGCCAAACCAAA
CTGACAATAATGCTTGAAAAATTAGGAATGGATTATGATGGGCGGCCTCACTGTGGTCTTGATGACTCT
AAGAATATCGCCCGAATAGCAGTTCGAATGCTTCAGGATGGGTGTGAACTCCGAATCAACGAGAAAATG
CATGCAGGACAGCTAATGAGTGTGTCCTCTTCCTTACCAATAGAGGGCACTCCACCACCACAAATGCCA
CATTTTAGAAAGTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_153332
Insert Size 1050 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_153332.3
RefSeq Size 4615 bp
RefSeq ORF 1050 bp
Locus ID 90459
UniProt ID Q8IV48
Cytogenetics 8p23.1
MW 40.1 kDa
Summary RNA exonuclease that binds to the 3'-end of histone mRNAs and degrades them, suggesting that it plays an essential role in histone mRNA decay after replication. A 2' and 3'-hydroxyl groups at the last nucleotide of the histone 3'-end is required for efficient degradation of RNA substrates. Also able to degrade the 3'-overhangs of short interfering RNAs (siRNAs) in vitro, suggesting a possible role as regulator of RNA interference (RNAi). Requires for binding the 5'-ACCCA-3' sequence present in stem-loop structure. Able to bind other mRNAs. Required for 5.8S rRNA 3'-end processing. Also binds to 5.8s ribosomal RNA. Binds with high affinity to the stem-loop structure of replication-dependent histone pre-mRNAs.[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:HEXO (ERI1) (NM_153332) Human Untagged Clone
Your Rating
SKU Description Size Price
RC206777 ERI1 (Myc-DDK-tagged)-Human exoribonuclease 1 (ERI1) 10 ug
$686.00
RC206777L1 Lenti ORF clone of Human exoribonuclease 1 (ERI1), Myc-DDK-tagged 10 ug
$986.00
RC206777L2 Lenti ORF clone of Human exoribonuclease 1 (ERI1), mGFP tagged 10 ug
$986.00
RC206777L3 Lenti ORF clone of Human exoribonuclease 1 (ERI1), Myc-DDK-tagged 10 ug
$986.00
RC206777L4 Lenti ORF clone of Human exoribonuclease 1 (ERI1), mGFP tagged 10 ug
$986.00
RG206777 ERI1 (tGFP-tagged) - Human exoribonuclease 1 (ERI1) 10 ug
$886.00
SC321806 ERI1 (untagged)-Human exoribonuclease 1 (ERI1) 10 ug
$457.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.