GET3 (NM_004317) Human Untagged Clone

SKU
SC317543
ASNA1 (untagged)-Human arsA arsenite transporter, ATP-binding, homolog 1 (bacterial) (ASNA1)
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol GET3
Synonyms ARSA-I; ARSA1; ASNA-I; ASNA1; TRC40
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC317543 representing NM_004317.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGGCAGGGGTGGCCGGGTGGGGGGTTGAGGCAGAGGAGTTCGAAGATGCTCCTGATGTGGAGCCG
CTGGAGCCTACACTTAGCAACATCATCGAGCAGCGCAGCCTGAAGTGGATCTTCGTCGGGGGCAAGGGT
GGTGTGGGCAAGACCACCTGCAGCTGCAGCCTGGCAGTCCAGCTCTCCAAGGGGCGTGAGAGTGTTCTG
ATCATCTCCACAGACCCAGCACACAACATCTCAGATGCTTTTGACCAGAAGTTCTCAAAGGTGCCTACC
AAGGTCAAAGGCTATGACAACCTCTTTGCTATGGAGATTGACCCCAGCCTGGGCGTGGCGGAGCTGCCT
GACGAGTTCTTCGAGGAGGACAACATGCTGAGCATGGGCAAGAAGATGATGCAGGAGGCCATGAGCGCA
TTTCCCGGCATCGATGAGGCCATGAGCTATGCCGAGGTCATGAGGCTGGTGAAGGGCATGAACTTCTCG
GTGGTGGTATTTGACACGGCACCCACGGGCCACACCCTGAGGCTGCTCAACTTCCCCACCATCGTGGAG
CGGGGCCTGGGCCGGCTTATGCAGATCAAGAACCAGATCAGCCCTTTCATCTCACAGATGTGCAACATG
CTGGGCCTGGGGGACATGAACGCAGACCAGCTGGCCTCCAAGCTGGAGGAGACGCTGCCCGTCATCCGC
TCAGTCAGCGAACAGTTCAAGGACCCTGAGCAGACAACTTTCATCTGCGTATGCATTGCTGAGTTCCTG
TCCCTGTATGAGACAGAGAGGCTGATCCAGGAGCTGGCCAAGTGCAAGATTGACACACACAATATAATT
GTCAACCAGCTCGTCTTCCCCGACCCCGAGAAGCCCTGCAAGATGTGTGAGGCCCGTCACAAGATCCAG
GCCAAGTATCTGGACCAGATGGAGGACCTGTATGAAGACTTCCACATCGTGAAGCTGCCGCTGTTACCC
CATGAGGTGCGGGGGGCAGACAAGGTCAACACCTTCTCGGCCCTCCTCCTGGAGCCCTACAAGCCCCCC
AGTGCCCAGTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_004317
Insert Size 1047 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_004317.3
RefSeq Size 1332 bp
RefSeq ORF 1047 bp
Locus ID 439
UniProt ID O43681
Cytogenetics 19p13.13
Domains ArsA_ATPase
MW 38.8 kDa
Summary This gene represents the human homolog of the bacterial arsA gene, encoding the arsenite-stimulated ATPase component of the arsenite transporter responsible for resistance to arsenicals. This protein is also a central component of a transmembrane domain (TMD) recognition complex (TRC) that is involved in the post-translational delivery of tail-anchored (TA) proteins from the cytosol to the endoplasmic reticulum (ER). It recognizes and selectively binds the TMD of TA proteins in the cytosol, and delivers them to the ER for insertion. [provided by RefSeq, Oct 2011]
Write Your Own Review
You're reviewing:GET3 (NM_004317) Human Untagged Clone
Your Rating
SKU Description Size Price
RC201194 ASNA1 (Myc-DDK-tagged)-Human arsA arsenite transporter, ATP-binding, homolog 1 (bacterial) (ASNA1) 10 ug
$457.00
RC201194L1 Lenti ORF clone of Human arsA arsenite transporter, ATP-binding, homolog 1 (bacterial) (ASNA1), Myc-DDK-tagged 10 ug
$757.00
RC201194L2 Lenti ORF clone of Human arsA arsenite transporter, ATP-binding, homolog 1 (bacterial) (ASNA1), mGFP tagged 10 ug
$757.00
RC201194L3 Lenti ORF clone of Human arsA arsenite transporter, ATP-binding, homolog 1 (bacterial) (ASNA1), Myc-DDK-tagged 10 ug
$757.00
RC201194L4 Lenti ORF clone of Human arsA arsenite transporter, ATP-binding, homolog 1 (bacterial) (ASNA1), mGFP tagged 10 ug
$757.00
RG201194 ASNA1 (tGFP-tagged) - Human arsA arsenite transporter, ATP-binding, homolog 1 (bacterial) (ASNA1) 10 ug
$657.00
SC319116 ASNA1 (untagged)-Human arsA arsenite transporter, ATP-binding, homolog 1 (bacterial) (ASNA1) 10 ug
$457.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.