TAS2R39 (NM_176881) Human Untagged Clone

SKU
SC317519
TAS2R39 (untagged)-Human taste receptor, type 2, member 39 (TAS2R39)
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol TAS2R39
Synonyms T2R39; T2R57
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC317519 representing NM_176881.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCTAGGGAGATGTTTTCCTCCAGACACCAAAGAGAAGCAACAGCTCAGAATGACTAAACTCTGCGAT
CCTGCAGAAAGTGAATTGTCGCCATTTCTCATCACCTTAATTTTAGCAGTTTTACTTGCTGAATACCTC
ATTGGTATCATTGCAAATGGTTTCATCATGGCTATACATGCAGCTGAATGGGTTCAAAATAAGGCAGTT
TCCACAAGTGGCAGGATCCTGGTTTTCCTGAGTGTATCCAGAATAGCTCTCCAAAGCCTCATGATGTTA
GAAATTACCATCAGCTCAACCTCCCTAAGTTTTTATTCTGAAGACGCTGTATATTATGCATTCAAAATA
AGTTTTATATTCTTAAATTTTTGTAGCCTGTGGTTTGCTGCCTGGCTCAGTTTCTTCTACTTTGTGAAG
ATTGCCAATTTCTCCTACCCCCTTTTCCTCAAACTGAGGTGGAGAATTACTGGATTGATACCCTGGCTT
CTGTGGCTGTCCGTGTTTATTTCCTTCAGTCACAGCATGTTCTGCATCAACATCTGCACTGTGTATTGT
AACAATTCTTTCCCTATCCACTCCTCCAACTCCACTAAGAAAACATACTTGTCTGAGATCAATGTGGTC
GGTCTGGCTTTTTTCTTTAACCTGGGGATTGTGACTCCTCTGATCATGTTCATCCTGACAGCCACCCTG
CTGATCCTCTCTCTCAAGAGACACACCCTACACATGGGAAGCAATGCCACAGGGTCCAACGACCCCAGC
ATGGAGGCTCACATGGGGGCCATCAAAGCTATCAGCTACTTTCTCATTCTCTACATTTTCAATGCAGTT
GCTCTGTTTATCTACCTGTCCAACATGTTTGACATCAACAGTCTGTGGAATAATTTGTGCCAGATCATC
ATGGCTGCCTACCCTGCCAGCCACTCAATTCTACTGATTCAAGATAACCCTGGGCTGAGAAGAGCCTGG
AAGCGGCTTCAGCTTCGACTTCATCTTTACCCAAAAGAGTGGACTCTGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_176881
Insert Size 1017 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_176881.2
RefSeq Size 1017 bp
RefSeq ORF 1017 bp
Locus ID 259285
UniProt ID P59534
Cytogenetics 7q34
Protein Pathways Taste transduction
MW 38.6 kDa
Summary The protein encoded by this gene is a bitter taste receptor that detects green tea catechins, soy isoflavones, and theaflavins. The encoded protein is gustducin-linked and may activate alpha gustducin. This gene is intronless. [provided by RefSeq, Dec 2015]
Write Your Own Review
You're reviewing:TAS2R39 (NM_176881) Human Untagged Clone
Your Rating
SKU Description Size Price
RC213629 TAS2R39 (Myc-DDK-tagged)-Human taste receptor, type 2, member 39 (TAS2R39) 10 ug
$457.00
RC213629L1 Lenti ORF clone of Human taste receptor, type 2, member 39 (TAS2R39), Myc-DDK-tagged 10 ug
$757.00
RC213629L2 Lenti ORF clone of Human taste receptor, type 2, member 39 (TAS2R39), mGFP tagged 10 ug
$757.00
RC213629L3 Lenti ORF clone of Human taste receptor, type 2, member 39 (TAS2R39), Myc-DDK-tagged 10 ug
$757.00
RC213629L4 Lenti ORF clone of Human taste receptor, type 2, member 39 (TAS2R39), mGFP tagged 10 ug
$757.00
RG213629 TAS2R39 (tGFP-tagged) - Human taste receptor, type 2, member 39 (TAS2R39) 10 ug
$489.00 MSRP $657.00 MSRP $657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.