CAB39L (NM_030925) Human Untagged Clone

SKU
SC317517
CAB39L (untagged)-Human calcium binding protein 39-like (CAB39L), transcript variant 1
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol CAB39L
Synonyms bA103J18.3; MO2L; MO25-BETA
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC317517 representing NM_030925.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAAAAAAATGCCTTTGTTTAGTAAATCACACAAAAATCCAGCAGAAATTGTGAAAATCCTGAAAGAC
AATTTGGCCATTTTGGAAAAGCAAGACAAAAAGACAGACAAGGCTTCAGAAGAAGTGTCTAAATCACTG
CAAGCAATGAAAGAAATTCTGTGTGGTACAAACGAGAAAGAACCCCCAACAGAAGCAGTGGCTCAGCTA
GCACAAGAACTCTACAGCAGTGGCCTGCTAGTGACACTGATAGCTGACCTGCAGCTGATAGACTTTGAG
GGAAAAAAAGATGTGACCCAGATATTTAACAACATCTTGAGAAGACAGATAGGCACTCGGAGTCCTACT
GTGGAGTATATTAGTGCTCATCCTCATATCCTGTTTATGCTCCTCAAAGGATATGAAGCCCCACAGATT
GCCTTACGTTGTGGGATTATGCTGAGAGAATGTATTCGACATGAACCACTTGCCAAAATCATCCTCTTT
TCTAATCAATTCAGAGATTTCTTTAAGTACGTGGAGTTGTCAACATTTGATATTGCTTCAGATGCCTTT
GCTACTTTCAAGGATTTACTAACCAGACATAAAGTGTTGGTAGCAGACTTCTTAGAACAAAATTACGAC
ACTATTTTTGAAGACTATGAGAAATTGCTTCAGTCTGAGAATTATGTTACTAAGAGACAGTCTTTAAAG
CTGCTAGGGGAGCTGATCCTGGACCGTCACAACTTTGCCATCATGACAAAGTATATCAGCAAGCCGGAG
AACCTGAAACTCATGATGAACCTCCTTCGGGATAAAAGTCCCAACATCCAGTTTGAAGCCTTTCATGTT
TTTAAGGTGTTTGTGGCCAGTCCTCACAAAACACAGCCTATTGTGGAGATCCTGTTAAAAAATCAGCCC
AAACTCATTGAGTTTCTGAGCAGCTTCCAAAAAGAAAGGACGGATGATGAGCAGTTCGCTGACGAGAAG
AACTACTTGATTAAACAGATCCGAGACTTGAAGAAAACGGCCCCTTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_030925
Insert Size 1014 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_030925.3
RefSeq Size 3631 bp
RefSeq ORF 1014 bp
Locus ID 81617
UniProt ID Q9H9S4
Cytogenetics 13q14.2
Domains Mo25
Protein Pathways mTOR signaling pathway
MW 39.1 kDa
Summary Component of a complex that binds and activates STK11/LKB1. In the complex, required to stabilize the interaction between CAB39/MO25 (CAB39/MO25alpha or CAB39L/MO25beta) and STK11/LKB1 (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (5) lacks several exons, and contains an alternate exon in the 5' non-coding region compared to variant 1. Variants 1-5 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:CAB39L (NM_030925) Human Untagged Clone
Your Rating
SKU Description Size Price
RC203394 CAB39L (Myc-DDK-tagged)-Human calcium binding protein 39-like (CAB39L), transcript variant 1 10 ug
$457.00
RC203394L3 Lenti ORF clone of Human calcium binding protein 39-like (CAB39L), transcript variant 1, Myc-DDK-tagged 10 ug
$757.00
RC203394L4 Lenti ORF clone of Human calcium binding protein 39-like (CAB39L), transcript variant 1, mGFP tagged 10 ug
$757.00
RG203394 CAB39L (tGFP-tagged) - Human calcium binding protein 39-like (CAB39L), transcript variant 1 10 ug
$489.00 MSRP $657.00 MSRP $657.00
SC109180 CAB39L (untagged)-Human calcium binding protein 39-like (CAB39L), transcript variant 1 10 ug
$300.00
SC320905 CAB39L (untagged)-Human calcium binding protein 39-like (CAB39L), transcript variant 1 10 ug
$457.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.