HAGH (NM_005326) Human Untagged Clone

SKU
SC317462
HAGH (untagged)-Human hydroxyacylglutathione hydrolase (HAGH), nuclear gene encoding mitochondrial protein, transcript variant 1
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol HAGH
Synonyms GLO2; GLX2; GLXII; HAGH1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC317462 representing NM_005326.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGTGGTGGGCCGAGGGCTGCTCGGCCGCCGCAGCCTCGCCGCGCTGGGAGCCGCCTGCGCCCGCCGA
GGCCTCGGTCCAGCCCTGCTGGGAGTTTTCTGCCACACAGATTTGCGGAAGAACCTGACCGTGGACGAG
GGCACCATGAAGGTAGAGGTGCTGCCTGCCCTGACCGACAACTACATGTACCTGGTCATTGATGATGAG
ACCAAGGAGGCTGCCATTGTGGATCCGGTGCAGCCCCAGAAGGTCGTGGACGCGGCGAGAAAGCACGGG
GTGAAACTGACCACAGTGCTCACCACCCACCACCACTGGGACCATGCTGGCGGGAATGAGAAACTGGTC
AAGCTGGAGTCGGGACTGAAGGTGTACGGGGGTGACGACCGTATCGGGGCCCTGACTCACAAGATCACT
CACCTGTCCACACTGCAGGTGGGGTCTCTGAACGTCAAGTGCCTGGCGACCCCGTGCCACACTTCAGGA
CACATTTGTTACTTCGTGAGCAAGCCCGGAGGCTCGGAGCCCCCTGCCGTGTTCACAGGTGACACCTTG
TTTGTGGCTGGCTGCGGGAAGTTCTATGAAGGGACTGCGGATGAGATGTGTAAAGCTCTGCTGGAGGTC
TTGGGCCGGCTCCCCCCGGACACAAGAGTCTACTGTGGCCACGAGTACACCATCAACAACCTCAAGTTT
GCACGCCACGTGGAGCCCGGCAATGCCGCCATCCGGGAGAAGCTGGCCTGGGCCAAGGAGAAGTACAGC
ATCGGGGAGCCCACAGTGCCATCCACCCTGGCAGAGGAGTTTACCTACAACCCCTTCATGAGAGTGAGG
GAGAAGACGGTGCAGCAGCACGCAGGTGAGACGGACCCGGTGACCACCATGCGGGCCGTGCGCAGGGAG
AAGGACCAGTTCAAGATGCCCCGGGACTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_005326
Insert Size 927 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_005326.4
RefSeq Size 1552 bp
RefSeq ORF 927 bp
Locus ID 3029
UniProt ID Q16775
Cytogenetics 16p13.3
Domains lactamase_B
Protein Families Druggable Genome
Protein Pathways Pyruvate metabolism
MW 33.8 kDa
Summary The enzyme encoded by this gene is classified as a thiolesterase and is responsible for the hydrolysis of S-lactoyl-glutathione to reduced glutathione and D-lactate. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2013]
Transcript Variant: This variant (1) encodes a mitochondrially localized isoform (1). Translation may also initiate at a downstream in-frame ATG to encode the cytosolic form.
Write Your Own Review
You're reviewing:HAGH (NM_005326) Human Untagged Clone
Your Rating
SKU Description Size Price
RC201109 HAGH (Myc-DDK-tagged)-Human hydroxyacylglutathione hydrolase (HAGH), nuclear gene encoding mitochondrial protein, transcript variant 1 10 ug
$300.00
RC201109L1 Lenti ORF clone of Human hydroxyacylglutathione hydrolase (HAGH), nuclear gene encoding mitochondrial protein, transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC201109L2 Lenti ORF clone of Human hydroxyacylglutathione hydrolase (HAGH), nuclear gene encoding mitochondrial protein, transcript variant 1, mGFP tagged 10 ug
$600.00
RC201109L3 Lenti ORF clone of Human hydroxyacylglutathione hydrolase (HAGH), nuclear gene encoding mitochondrial protein, transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC201109L4 Lenti ORF clone of Human hydroxyacylglutathione hydrolase (HAGH), nuclear gene encoding mitochondrial protein, transcript variant 1, mGFP tagged 10 ug
$600.00
RG201109 HAGH (tGFP-tagged) - Human hydroxyacylglutathione hydrolase (HAGH), nuclear gene encoding mitochondrial protein, transcript variant 1 10 ug
$489.00 MSRP $500.00 MSRP $500.00
SC319067 HAGH (untagged)-Human hydroxyacylglutathione hydrolase (HAGH), nuclear gene encoding mitochondrial protein, transcript variant 1 10 ug
$300.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.