BPNT1 (NM_006085) Human Untagged Clone

SKU
SC317461
BPNT1 (untagged)-Human 3'(2'), 5'-bisphosphate nucleotidase 1 (BPNT1)
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol BPNT1
Synonyms HEL20; PIP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC317461 representing NM_006085.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCTTCCAGTAACACTGTGTTGATGCGGTTGGTAGCCTCCGCATATTCTATTGCTCAAAAGGCAGGA
ATGATAGTCAGACGTGTTATTGCTGAAGGAGACCTGGGTATTGTGGAGAAGACCTGTGCAACAGACCTG
CAGACCAAAGCTGACCGATTGGCACAGATGAGCATATGTTCTTCATTGGCCCGGAAATTCCCCAAACTC
ACAATTATAGGGGAAGAGGATCTGCCTTCTGAGGAAGTGGATCAAGAGCTGATTGAAGACAGTCAGTGG
GAAGAAATACTGAAGCAACCATGCCCATCGCAGTACAGTGCTATTAAAGAAGAAGATCTCGTGGTCTGG
GTTGATCCTCTGGATGGAACCAAGGAATATACCGAAGGTCTTCTTGACAATGTAACAGTTCTTATTGGA
ATTGCTTATGAAGGAAAAGCCATAGCAGGAGTTATTAACCAGCCATATTACAACTATGAGGCAGGACCA
GATGCTGTGTTGGGGAGGACAATCTGGGGAGTTTTAGGTTTAGGCGCCTTTGGGTTTCAGCTGAAAGAA
GTCCCTGCTGGGAAACACATTATCACAACTACTCGATCCCATAGCAACAAGTTGGTTACTGACTGTGTT
GCTGCTATGAACCCCGATGCTGTGCTGCGAGTAGGAGGAGCAGGAAATAAGATTATTCAGCTGATTGAA
GGCAAAGCCTCTGCTTATGTATTTGCAAGTCCTGGTTGTAAGAAGTGGGATACTTGTGCTCCAGAAGTT
ATTTTACATGCTGTGGGAGGCAAGTTAACCGATATCCATGGGAATGTTCTTCAGTACCACAAGGATGTG
AAGCATATGAACTCTGCAGGAGTCCTGGCCACACTGAGGAATTATGACTACTATGCAAGCCGAGTTCCA
GAATCTATTAAAAATGCACTTGTTCCTTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_006085
Insert Size 927 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_006085.5
RefSeq Size 2465 bp
RefSeq ORF 927 bp
Locus ID 10380
UniProt ID O95861
Cytogenetics 1q41
Domains inositol_P
Protein Pathways Sulfur metabolism
MW 33.4 kDa
Summary BPNT1, also called bisphosphate 3-prime-nucleotidase, or BPntase, is a member of a magnesium-dependent phosphomonoesterase family. Lithium, a major drug used to treat manic depression, acts as an uncompetitive inhibitor of BPntase. The predicted human protein is 92% identical to mouse BPntase. BPntase's physiologic role in nucleotide metabolism may be regulated by inositol signaling pathways. The inhibition of human BPntase may account for lithium-induced nephrotoxicity. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:BPNT1 (NM_006085) Human Untagged Clone
Your Rating
SKU Description Size Price
RC216622 BPNT1 (Myc-DDK-tagged)-Human 3'(2'), 5'-bisphosphate nucleotidase 1 (BPNT1) 10 ug
$300.00
RC216622L1 Lenti ORF clone of Human 3'(2'), 5'-bisphosphate nucleotidase 1 (BPNT1), Myc-DDK-tagged 10 ug
$600.00
RC216622L2 Lenti ORF clone of Human 3'(2'), 5'-bisphosphate nucleotidase 1 (BPNT1), mGFP tagged 10 ug
$600.00
RC216622L3 Lenti ORF clone of Human 3'(2'), 5'-bisphosphate nucleotidase 1 (BPNT1), Myc-DDK-tagged 10 ug
$600.00
RC216622L4 Lenti ORF clone of Human 3'(2'), 5'-bisphosphate nucleotidase 1 (BPNT1), mGFP tagged 10 ug
$600.00
RG216622 BPNT1 (tGFP-tagged) - Human 3'(2'), 5'-bisphosphate nucleotidase 1 (BPNT1) 10 ug
$489.00 MSRP $500.00 MSRP $500.00
SC116312 BPNT1 (untagged)-Human 3'(2'), 5'-bisphosphate nucleotidase 1 (BPNT1) 10 ug
$300.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.