MED8 (NM_052877) Human Untagged Clone

SKU
SC317443
MED8 (untagged)-Human mediator complex subunit 8 (MED8), transcript variant 3
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol MED8
Synonyms ARC32
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC317443 representing NM_052877.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCAGAGAGAGGAGAAGCAGCTTGAGGCATCATTAGATGCACTGCTGAGTCAAGTGGCTGATCTGAAG
AACTCTCTGGGGAGTTTCATTTGCAAGTTGGAGAACGAGTATGGCCGGCTGACCTGGCCATCTGTCCTG
GACAGCTTTGCCTTGCTTTCTGGACAGCTGAACACTCTGAACAAGGTCTTGAAGCATGAAAAAACACCG
CTGTTCCGTAACCAGGTCATCATTCCTCTGGTGTTGTCTCCAGACCGAGATGAAGATCTCATGCGGCAG
ACTGAAGGACGGGTGCCTGTTTTCAGCCATGAGGTAGTCCCTGACCATCTGAGAACCAAGCCTGACCCT
GAAGTGGAAGAACAGGAGAAGCAACTGACGACAGATGCTGCCCGCATTGGTGCAGATGCAGCCCAGAAG
CAGATCCAGAGCTTGAATAAAATGTGTTCAAACCTTCTGGAGAAAATCAGCAAAGAGGAGCGAGAATCA
GAGAGTGGAGGTCTCCGGCCGAACAAGCAGACCTTTAACCCTACAGACACTAATGCCTTGGTGGCAGCT
GTTGCCTTTGGGAAAGGACTATCTAATTGGAGACCTTCAGGCAGCAGTGGTCCTGGCCAGGCAGGCCAG
CCAGGAGCTGGGACGATCCTTGCAGGAACCTCAGGATTACAGCAGGTGCAGATGGCAGGAGCTCCAAGC
CAGCAGCAGCCAATGCTCAGTGGGGTACAAATGGCTCAGGCAGGTCAACCAGGGAAAATGCCAAGTGGA
ATAAAAACCAACATCAAGTCGGCTTCCATGCATCCCTACCAGCGGCCCTCCTGCCTGGGTTTCATTCTG
GCTATCCCTCTAAGGCGCAAGGTGAAGAAGCTTCTGGGCCAGGAAGGAAAAAAAAATGCCCACCTGCAG
CTCTGGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_052877
Insert Size 906 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_052877.4
RefSeq Size 1496 bp
RefSeq ORF 906 bp
Locus ID 112950
UniProt ID Q96G25
Cytogenetics 1p34.2
Protein Families Druggable Genome, Transcription Factors
MW 32.8 kDa
Summary This gene encodes a protein component of the mediator complex, which aids in transcriptional activation through interaction with RNA polymerase II and gene-specific transcription factors. The encoded protein may also function in ubiquitin ligation and protein degradation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2013]
Transcript Variant: This variant (3) represents the shortest transcript and encodes the longest isoform (3).
Write Your Own Review
You're reviewing:MED8 (NM_052877) Human Untagged Clone
Your Rating
SKU Description Size Price
RC203883 MED8 (Myc-DDK-tagged)-Human mediator complex subunit 8 (MED8), transcript variant 3 10 ug
$300.00
RC203883L3 Lenti ORF clone of Human mediator complex subunit 8 (MED8), transcript variant 3, Myc-DDK-tagged 10 ug
$600.00
RC203883L4 Lenti ORF clone of Human mediator complex subunit 8 (MED8), transcript variant 3, mGFP tagged 10 ug
$600.00
RG203883 MED8 (tGFP-tagged) - Human mediator complex subunit 8 (MED8), transcript variant 3 10 ug
$489.00 MSRP $500.00 MSRP $500.00
SC317445 MED8 (untagged)-Human mediator complex subunit 8 (MED8), transcript variant 3 10 ug
$330.00
SC322304 MED8 (untagged)-Human mediator complex subunit 8 (MED8), transcript variant 3 10 ug
$300.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.