TESC (NM_017899) Human Untagged Clone

SKU
SC317387
TESC (untagged)-Human tescalcin (TESC), transcript variant 1
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol TESC
Synonyms CHP3; TSC
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC317387 representing NM_017899.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGCGCTGCCCACTCCGCGTCTGAGGAGGTGCGGGAGCTCGAGGGCAAGACCGGCTTCTCATCGGAT
CAGATCGAGCAGCTCCATCGGAGATTTAAGCAGCTGAGTGGAGATCAGCCTACCATTCGCAAGGAGAAC
TTCAACAATGTCCCGGACCTGGAGCTCAACCCCATCCGATCCAAAATTGTTCGTGCCTTCTTCGACAAC
AGGAACCTGCGCAAGGGACCCAGTGGCCTGGCTGATGAGATCAATTTCGAGGACTTCCTGACCATCATG
TCCTACTTCCGGCCCATCGACACCACCATGGACGAGGAACAGGTGGAGCTGTCCCGGAAGGAGAAGCTG
AGATTTCTGTTCCACATGTACGACTCGGACAGCGACGGCCGCATCACTCTGGAAGAATATCGAAATGTG
GTCGAGGAGCTGCTGTCGGGAAACCCTCACATCGAGAAGGAGTCCGCTCGCTCCATCGCCGACGGGGCC
ATGATGGAGGCGGCCAGCGTGTGCATGGGGCAGATGGAGCCTGATCAGGTGTACGAGGGGATCACCTTC
GAGGACTTCCTGAAGATCTGGCAGGGGATCGACATTGAGACCAAGATGCACGTCCGCTTCCTTAACATG
GAAACCATGGCCCTCTGCCACTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_017899
Insert Size 645 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_017899.3
RefSeq Size 1039 bp
RefSeq ORF 645 bp
Locus ID 54997
UniProt ID Q96BS2
Cytogenetics 12q24.22
MW 24.7 kDa
Summary Functions as an integral cofactor in cell pH regulation by controlling plasma membrane-type Na(+)/H(+) exchange activity. Promotes the maturation, transport, cell surface stability and exchange activity of SLC9A1/NHE1 at the plasma membrane. Promotes the induction of hematopoietic stem cell differentiation toward megakaryocytic lineage. Essential for the coupling of ERK cascade activation with the expression of ETS family genes in megakaryocytic differentiation. Also involved in granulocytic differentiation in a ERK-dependent manner. Inhibits the phosphatase activity of calcineurin.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) encodes the longer isoform (1).
Write Your Own Review
You're reviewing:TESC (NM_017899) Human Untagged Clone
Your Rating
SKU Description Size Price
RC222650 TESC (Myc-DDK-tagged)-Human tescalcin (TESC), transcript variant 1 10 ug
$300.00
RC222650L3 Lenti ORF clone of Human tescalcin (TESC), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC222650L4 Lenti ORF clone of Human tescalcin (TESC), transcript variant 1, mGFP tagged 10 ug
$600.00
RG222650 TESC (tGFP-tagged) - Human tescalcin (TESC), transcript variant 1 10 ug
$500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.